AAVS1 was targeted using gRNA (crRNA: 5′GGGGCCACTAGGGACAGGAT) via electroporation of Cas9/RNP into NK cells seven days after stimulation with FC21 as described before (Naeimi Kararoudi et al., 2018 (link)). Briefly, 3 × 106 expanded NK cells were harvested and washed twice with 13 mL of PBS followed by centrifugation for 5 min at 400 g and aspiration of PBS. The cell pellet was resuspended in 20ul of P3 Primary Cell 4D-Nucleofector Solution. 5ul of pre-complexed Cas9/RNP (Alt-R® CRISPR-Cas9 crRNA, Alt-R® CRISPR-Cas9 tracrRNA, or preassembled synthetic sgRNA (Synthego, Menlo Park, CA) and Alt-R® S.p. HiFi Cas9 Nuclease V3) (Integrated DNA Technologies, Inc., Coralville, Iowa), targeting AAVS1 and 1ul of 100uM electroporation enhancer (Alt-R® Cas9 Electroporation Enhancer) were added to the cell suspension. The total volume of 26ul of CRISPR reaction was transferred into 4D-Nucleofector™ 16-well Strip and electroporated using program EN-138. After electroporation, the cells were transferred into 2 mL of media containing 50 IU of IL-2 in a 12 well plate and incubated at 37 degrees and 5% CO2 pressure. Two days post electroporation, cells were stimulated with 2 × 106 feeder cells, and 8 mL fresh media complemented with 50 IU was added in cell suspension and kept in a T25 flask.
Alt r s p hifi cas9 nuclease v3
Manufactured by Integrated DNA Technologies
Sourced in United States
The Alt-R® S.p. HiFi Cas9 Nuclease V3 is a recombinant Cas9 nuclease enzyme from Streptococcus pyogenes, engineered to have high fidelity. It is designed for use in CRISPR-Cas9 genome editing applications.
Automatically generated - may contain errors
Lab products found in correlation
Gotaq g2 polymerase, by Promega (1 mentions)
Lipofectamine crisprmax, by Thermo Fisher Scientific (1 mentions)
Neon transfection system, by Thermo Fisher Scientific (1 mentions)
Puromycin, by Thermo Fisher Scientific (1 mentions)
Neon transfection system 10 μl kit, by Thermo Fisher Scientific (1 mentions)
Amaxa p3 primary cell 4d nucleofector x kit l, by Lonza (1 mentions)
Amaxa 4d nucleofector, by Lonza (1 mentions)
Ultramer dna oligo, by Integrated DNA Technologies (1 mentions)
Anti cd4 apc, by BD (1 mentions)
Anti cd8 fitc, by BD (1 mentions)
Dynabeads human t activator cd3 cd28, by Thermo Fisher Scientific (1 mentions)
P3 primary cell 4d nucleofector x kit l, by Lonza (1 mentions)
Anti cd90.1 pe, by BioLegend (1 mentions)
Facsaria cell sorter, by BD (1 mentions)
Opti mem, by Thermo Fisher Scientific (1 mentions)
Alt r crispr cas9 system, by Integrated DNA Technologies (1 mentions)
Alt r crispr cas9 crrna, by Integrated DNA Technologies (1 mentions)
12 protocols using alt r s p hifi cas9 nuclease v3
1
CRISPR-Cas9 Editing of NK Cells
2
NRXN1 Ribonucleoprotein Complex Formation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the formation of ribonucleoprotein complexes (RNP), a synthetic sgRNA targeting the 3′-UTR of NRXN1 (Integrated DNA Technologies) was incubated with Alt-R S.p. HiFi Cas9 Nuclease V3 (1081060, Integrated DNA Technologies) for 10 min at an equimolar sgRNA:Cas9 ratio in a concentration of 37 μM. The genomic sgRNA target sequence (with protospacer adjacent motif in bold) is 5′-TTGGGTTGGCTATAGAAAAG AGG . Briefly, 300,000 cells from control (Ctrl1) and mutant (qKO1) pretreated with thiazovivin were transfected with RNP complexes, as described above, and immediately infected with 4.5 μl of AAV supernatant expressing NRXN1–cTR-targeting vector as repair template. Targeted cells were selected with puromycin for 72 h and single-cell sorted by fluorescence-activated cell sorting for isolation of monoclonal lines.
3
Generating CRISPR-Cas9 Knockout Jurkat T Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human leukemic Jurkat T cells were obtained from the American Type Culture Collection (clone E6-1). Jurkat T cells were cultured in complete RPMI-1640 medium supplemented with 10% FBS and 5% Penn-Strep. Murine P815 mastocytoma cell line was used from the American Type Culture Collection (Manassas, USA) and cultured in complete DMEM medium supplemented with 10% FBS and 5% Penn-Strep. Primary CD8+ T cells were obtained from unidentified human samples from the Human Immunology Core at the University of Pennsylvania. Isolated human CD8+ cells were expanded using Dynabeads (Human T-Expander CD3/CD28 from Life Technologies) and human recombinant IL-2 for 5 days in complete medium. After, beads were removed using a magnet and cells were used for various experiments.
CRISPR–Cas9 knockout Jurkat T cells were generated by electroporating single guide RNA (sgRNA) specifically designed to target genomic DNA together with Alt-R S.p Hifi Cas9 nuclease V3 (Integrated DNA Technologies). The sgRNA sequences used were the following: ESYT1 gRNA: CGGTGCTGACTTCATTCGGG and ESYT2 gRNA: GTGATCCTGGAACCGTTGAT. Seventy-two hours post-transfection, serial dilutions were made for single-cell cultures into 96-well plates. Single-cell clones were screened using western blotting with actin as a loading control. Successful E-Syt1, E-Syt2, and E-Syt1&2 knockout clones were expanded, and stocks were frozen.
CRISPR–Cas9 knockout Jurkat T cells were generated by electroporating single guide RNA (sgRNA) specifically designed to target genomic DNA together with Alt-R S.p Hifi Cas9 nuclease V3 (Integrated DNA Technologies). The sgRNA sequences used were the following: ESYT1 gRNA: CGGTGCTGACTTCATTCGGG and ESYT2 gRNA: GTGATCCTGGAACCGTTGAT. Seventy-two hours post-transfection, serial dilutions were made for single-cell cultures into 96-well plates. Single-cell clones were screened using western blotting with actin as a loading control. Successful E-Syt1, E-Syt2, and E-Syt1&2 knockout clones were expanded, and stocks were frozen.
4
CRISPR-Cas9 Genome Editing in WI38 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genome editing of WI38 was performed with CRISPR-Cas9 tools in ribonucleic particle (RNP) format. Briefly, the Alt-R S.p. HiFi Cas9 nuclease V3 (Integrated DNA Technologies [IDT]) was assembled with an equimolar amount of hybridized single guide RNA (tracrRNA and crRNA from IDT) to generate RNPs. According to IDT recommendations, RNPs were transfected at 5 nM each with Lipofectamine CRISPRMAX (Thermofisher). Cells were harvested 1 week later to analyze the efficiency of genome editing. Genomic DNA was extracted with a Master Pure purification kit (Epicentre) according to the manufacturer’s instructions, except that 250 μg of proteinase K was used for cell lysis. Genome editing efficiency was checked by PCR on genomic DNA from the transfected population with the GoTaq G2 polymerase (Promega) using primers surrounding the 210-bp deleted region. PCR products were visualized on an agarose gel. Clones were then isolated and screened by PCR as described above. Two homozygous clones and one heterozygous clone were selected. The sequences of sgRNAs were the following: sgRNA-1, TAGGAGGCCAGTGCTCCAGG ; sgRNA-2, TTCCTGACTCTTGAAAACCA .
5
CRISPR-Cas9 Knockout of CDKN1B
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Alt-R® CRISPR-Cas9 crRNA against CDKN1B (Design ID: Hs.Cas9.CDKN1B.1.AA), Alt-R® CRISPR-Cas9 tracrRNA, and Alt-R® S.p. HiFi Cas9 Nuclease V3 were purchased from Integrated DNA Technologies (Coralville, IA, USA). Formation of guide RNA (crRNA:tracrRNA duplex), formation of the Cas9–guide RNA complex, and electroporation using the Neon transfection system (Thermo Fisher Scientific, Waltham, MA, USA) were each performed in accordance with the manufacturer’s instructions. Clone selection and validation via immunoblotting and sequencing were then performed. All primers are listed in Table S2 .
6
Generating LITAF Knockout Zebrafish
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
WT AB/Tu zebrafish were crossed, and the resultant embryos were injected with a solution containing crRNA targeting LITAF (ATGGAGAACACGACCCTTGTGGG), Alt-R® tracrRNA, and Alt-R® S.p. HiFi Cas9 Nuclease V3 (all from Integrated DNA Technologies), according to the manufacturer's instructions. These F0 embryos were raised up and outcrossed individually to WT AB/Tu fish. Resultant F1 embryos were sequenced to identify clutches with frameshift mutations that are predicted to be loss-of-function mutations. Selected F1 clutches were raised, fin-clipped, and sequenced to confirm the mutation in each individual fish. Adult fish heterozygous for an 11-bp deletion in exon 2 of LITAF (c.45_55del), which is predicted to result in a severely truncated protein of 22 amino acids (p.L16PfsX8), were in-crossed. The resultant F2 embryos were WT, heterozygous, and homozygous for the 11-bp deletion in expected Mendelian ratios and were used for downstream experiments.
7
CRISPR-Cas9 Editing of Human iPSCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Custom Alt-R CRISPR-Cas9 crRNA and generic tracrRNA (1072532, Integrated DNA Technologies, IA, USA) were resuspended to 200 μM in a Tris-EDTA buffer solution (pH 8.0) (06890-54, Nacalai Tesque, Kyoto, Japan). Next, crRNA:tracrRNA complexes (gRNA) were generated by incubating equimolar ratios at 95°C for 5 min and then returning to room temperature. The custom crRNA sequence was 5′-acagtggggccactagggac-3′designed with reference to previous studies (Richardson et al., 2016 (link)). To form Cas9 RNP complexes, a mixture of gRNA and Alt-R S.p. HiFi Cas9 Nuclease V3 (1081060, Integrated DNA Technologies) was incubated for 15 min at room temperature. After complex formation, 1 × 105 human iPSCs were transfected using the Neon Transfection System 10 μL kit (MPK1025, Thermo Fisher Scientific) with the following electroporation settings: 1,200 V; 20 ms; 2 pulses. Subsequently, the cells were seeded onto new Geltrex-coated 24-well culture plates. In 48 h after electroporation, 0.5% puromycin (A1113803, Thermo Fisher Scientific) was added to the culture medium. After 9 days of puromycin selection, the expanded cell colonies were isolated and cultured on 6-well culture plates.
8
Efficient Gene Editing of Antiviral T Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Two million to 10 million antiviral T cells (half of the culture derived from 100 mL of peripheral blood) were electroporated with RNPs on day 7 of expansion using Amaxa P3 primary cell 4D-Nucleofector X Kit L and the Amaxa-Nucleofector-4D (Lonza, program CO-115) to transfer ribonucleoprotein complexes of 30 μg of recombinant Alt-R S.p. HiFi Cas9 Nuclease V3 (Integrated DNA Technologies)124 (link) precomplexed with 15 μg of synthetically modified sgRNA targeting 5’-GGGCGCACCTTCCCCAAGCG-3′ with 2O’-methyl-3'phosphothioate modifications between the first and last three nucleotides (Synthego Corporation). The same number of unmodified antiviral T cells were expanded as controls.
9
CRISPR-Cas9 and CRISPR-Cas12a Genome Editing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Alt-R ® CRISPR-SpCas9 and Alt-R ® CRISPR-AsCas12a reagents (Alt-R ® S.p. HiFi Cas9 nuclease V3, synthetic gRNA (sgRNA) (Labun et al.; Labun et al.; Nishimasu et al.) , Alt-R ® As AsCas12a V3 and crRNA), and ssODN HDR donor templates (Ultramer DNA oligos) and Alt-R ® SpCas9 or AsCas12a Electroporation enhancer buffers were from Integrated DNA Technologies (IDT) (Coralville, IA). Figure 1C provides the nucleotide sequences of the gRNAs and donor ssODNs.
10
Gene Editing of Activated T Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PBMCs were thawed and stimulated with Dynabeads human T-activator CD3-CD28 (11131D; Gibco) at a ratio of three beads for one cell in the presence of IL-2 (30 IU/ml). After 48 h, beads were removed, and the cells were electroporated using a P3 primary cell 4D-Nucleofector X kit L (V4XP-3024; Lonza) and the program EO-115. Before electroporation, RNP complexes were formed by incubating equal volumes of sgRNA (44 µM) and Alt-R S.p. HiFi Cas9 nuclease V3 (36 µM; 1081061; Integrated DNA Technologies) at room temperature for 20 min according to the manufacturer’s instructions. 1.5–3.0 × 106 activated T cells were electroporated with either 10 µl RNP plus 10 µg of HDR DNA template (edited T cells) or Cas9 alone (control T cells). Cells were analyzed by flow cytometry for CD90.1 expression 4 d after transfection using anti–CD4-APC (555349; BD Biosciences), anti–CD8-FITC (555366; BD Biosciences), and anti–CD90.1-PE (202524; BioLegend) antibodies. Edited T cells were sorted into CD4+CD90-1+ and CD8+CD90.1+ subpopulations 5 d after transfection using a FACS Aria cell sorter (BD Biosciences). CD4+CD90.1− cells and CD8+CD90.1− control T cells were sorted in parallel and used as negative controls.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!