ILs N-butyl diethanol ammonium bis(trifluoromethylsulfonyl)imide ([DEBA+][Ntf2-]), trihexyltetradecylphosphonium tris(pentafluoroethyl)trifluorophosphate ([N6,6,6,14+][FAP-]), trihexyltetradecylphosphonium bis(trifluoromethylsulfonyl)imide ([N6,6,6,14+][Ntf2-]), 1-butyl-1-methylpyrrolidinium bis(trifluoromethylsulfonyl)imide ([BMPyr+][Ntf2-]), and 1-hexyl-3-methylimidazolium tris(pentafluoroethyl)trifluorophosphate ([C6mim+][FAP-]), and precoated cellulose thin-layer chromatography (TLC) plates (20 × 20) were provided by Merck (Darmstadt, Germany). The NucleoSpin® tissue kit was provided by Macherey-Nagel (Düren, Germany). Diethylpyrocarbonate-treated water, primer, and probes were provided by Invitrogen (Lofer, Austria). MgCl2 (purity 98% or greater, CAS 7786-30-3), KCl (purity 99% or greater, CAS 7447-40-7), NaCl (purity 98% or greater, CAS 7647-14-5), amino acids as their l enantiomers (alanine, cysteine, glutamine, histidine, leucine, phenylalanine, tyrosine, and tryptophan, purity 99% or greater), monosaccharides as their d enantiomers (glucose, fructose, mannose, and galactose), and Taq polymerase were provided by Fisher Scientific (Vienna, Austria).
Diethylpyrocarbonate
Manufactured by Thermo Fisher Scientific
Sourced in United States
Diethylpyrocarbonate is a chemical reagent used in molecular biology and biochemistry laboratories. It is primarily used as an inhibitor of RNase enzymes, which are responsible for the degradation of RNA molecules. Diethylpyrocarbonate irreversibly inactivates RNase enzymes, allowing for the preservation and analysis of RNA samples.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
Propidium iodide, by Thermo Fisher Scientific (3 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (2 mentions)
Taq polymerase, by Thermo Fisher Scientific (1 mentions)
Sodium chloride (nacl), by Thermo Fisher Scientific (1 mentions)
Potassium chloride (kcl), by Thermo Fisher Scientific (1 mentions)
Mgcl2, by Thermo Fisher Scientific (1 mentions)
Nucleospin tissue kit, by Macherey-Nagel (1 mentions)
Reverse transcription kit, by Takara Bio (1 mentions)
Ultraviolet spectrophotometer, by Thermo Fisher Scientific (1 mentions)
Sybr green kit, by Takara Bio (1 mentions)
Cfx96 real time thermal cycler, by Bio-Rad (1 mentions)
Ethyl methanesulfonate, by HiMedia (1 mentions)
Dimethyl sulfoxide (dmso), by Thermo Fisher Scientific (1 mentions)
Annexin 5 fitc, by Thermo Fisher Scientific (1 mentions)
Ethidium bromide, by Merck Group (1 mentions)
Triton x 100, by Thermo Fisher Scientific (1 mentions)
Polyethylene glycol, by HiMedia (1 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions)
Chloroform, by Merck Group (1 mentions)
8 protocols using diethylpyrocarbonate
1
Ionic Liquid-Based Thin-Layer Chromatography
2
RNA Extraction and Quantification for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from blood samples and neurons using TRIzol reagent (Invitrogen), and RNA sediments were dissolved after addition of diethyl pyrocarbonate (Invitrogen). The concentration and purity of RNAs were measured with an ultraviolet spectrophotometer (Thermo Scientific, Wilmington, DE, USA) at the wavelength of 260 nm and 280 nm. After being synthesized from RNA with the assistance of reverse transcription kits (TAKARA, Shiga, Japan), cDNAs were amplified by referring to instructions of SYBR Green kit (TAKARA), following procedures of 1) 95℃ for 3 min and 2) 40 cycles of 95℃ for 12 s and 62℃ for 35 s. Primers for Zfas1 (forward, 5′-AAGCCACGTGCAGACATCTA-3′, reverse, 5′-CTACTTCCAACACCCGCATT-3′) and GAPDH (forward, 5′-GATTCCACCCATGGCAAATTC-3′, reverse, 5′-CTGGAAGATGGTGATGGGATT-3′) were provided by GenePharma.
3
Water Sample Processing and Storage
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Samples were transported with sample coolers to the laboratory and processed within 24 h of sample collection. The water samples were filtrated onto 0.4-μm polycarbonate filters (as large volume as possible, 40–250 ml of effluents, and 50–600 ml of surface water) (Whatman Nuclepore Track-Etched Membranes, Sigma-Aldrich, United States). The membranes were frozen immediately after filtration and stored at −75°C or lower. A volume of 100 ml sterile-filtered water treated with diethyl pyrocarbonate (Invitrogen, Thermo Fisher Scientific, United States) was filtrated as negative filtration control. The fecal samples were distributed into 250-mg aliquots, frozen immediately, and stored at −75°C or lower.
4
Optimized qRT-PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A total of 80 RNA samples from the different treatments were subjected to gene expression analysis. Reactions were done through qRT-PCR analysis in a total volume of 10 μL solution containing 1 μL of the RNA template, 5 μL of 2x KAPA FAST SYBR Kit (KAPA Biosystems, USA), 0.2 μL RT mix, 0.5 μL each of the 10 μM forward and reverse primers and 2.8 μL of Diethylpyrocarbonate- (DEPC-) treated water (Invitrogen, USA). β-actin served as the internal standard. The following conditions were used: initial hold 42 °C 5 min, hold at 95 °C 2 mins and 45 cycles of 95 °C for 20 s; 60 °C for 20 s; 72 °C for 20 s. Final extension at 72 °C for 10 min. The primers used were the following: internal standard β-actinF 5′-GCTACTCCTTCACCACCACAG-3′, β-actinR 5′-CGTCAGGCAGCTCGTAACTC-3′ [57 (link)]; csf1raF 5′-AACTGGAGGAGGAGCAGGTAATC-3′, csf1raR 5′-GTGACACTTAGGCTTGTCATACG-3 ′[58 (link)]; Bcdo2bF 5′-CCCCAGAGCCCATTACGA-3′, Bcdo2bR 5′- TTTCAAGTGTTTCTGGATC-3′ [48 (link)]; stARF 5′-ACCCCTCTGCTCAGGCATTT-3′, stARR 5′-GGGCTCCACCTGCTTCTTG-3′ [59 (link)]. Amplification was done using Bio-Rad CFX96TM Real-Time thermal cycler.
5
Characterization of miRNA-206 Effects on Cell Viability
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chloroauric acid (HAuCl4), sodium citrate (Na3C6H5O7), diethylpyrocarbonate (DEPC) were obtained from Invitrogen, Ethyl Methane Sulfonate (EMS), Polyethylene glycol (PEG average molecular weight (Mn-800)) were procured from HiMedia, miRNA − 206 mimic (UGGAAUGUAAGGAAGUGUGUGG), negative miRNA control (GGUUCGUACGUACACUGUUCA) from Sigma, Agarose, Ethidium bromide (EtBr), 2 M Tris base, acetic acid, 0.5 M EDTA (pH 8), Milli Q water, loading dye, Modified Eagle’s Media (MEM), Fetal Bovine Serum (FBS), sodium bicarbonate (NaHCO3), Gibco Antibiotic–Antimycotic solution, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), Dimethylsulfoxide (DMSO), 5,5,6,6′-tetrachloro-1,1′,3,3′ tetraethylbenzimi-dazoylcarbocyanine iodide (JC-1) dye, FITC-Annexin V, Propidium iodide, TRIzol Reagent, and Triton-X100 were obtained from Thermo Fisher.
6
Placental RNA Extraction Workflow
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The placental tissues were randomly collected from the central area of placenta and stored in liquid nitrogen. Total RNA was extracted from the placental tissue utilizing Trizol (Molecular Research Center Inc., Cincinnati, OH, USA) according to the manufacturer’s instructions with slight modifications. Briefly, after homogenization, the tissues were mixed with 1 mL of Trizol (Molecular Research Center Inc.) and allowed to stand for 10 minutes at room temperature. After adding 0.5 mL of chloroform (Sigma-Aldrich), the sample was then shaken vigorously for 10 seconds. It was then allowed to stand for 10 minutes at room temperature, followed by centrifugation at 13,000 rpm for 15 minutes at 4°C. The supernatant was transferred to a new tube and mixed with 0.4 mL of isopropanol (Merck, Kenilworth, NJ, USA) and allowed to stand at room temperature for 10 minutes. After centrifugation at 13,000 rpm for 15 minutes at 4°C, the RNA pellet was washed with 1 mL of 75% ethanol and centrifuged at 13,000 rpm for 5 minutes at 4°C. The RNA pellet was then air-dried for 10 minutes and dissolved in diethylpyrocarbonate-treated (Invitrogen) water at 65°C for 5 minutes. The total RNA was stored at –80°C until further analysis. The RNA was used to confirm the expression of mRNA and miRNA by gene array and quantitative real-time polymerase chain reaction (qRT-PCR) analyses.
7
Immunohistochemical Analysis of Cell Proliferation Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Ready-to-use anti-human mouse monoclonal antibody directed against proliferating cell nuclear antigen (PCNA), ready-to-use Ultra-Sensitive Immunohistochemical Streptavidin-Peroxidase (S-P) kit, ready-to-use mouse anti-human monoclonal antibody directed against p53, DAB Color Developing Reagent kit and poly-lysine were purchased from Beijing Zhongshan Golden Bridge Biotechnology Co., Ltd. (OriGene Technologies, Inc., Beijing, China). Mouse anti-human monoclonal antibody directed against Bcl-2 was purchased from Santa Cruz Biotechnology, Inc. (Dallas, TX, USA). The Quantum Dot Immunofluorescent Double-Staining Reagent kit was purchased from Wuhan Jiayuan Quantum Dot Technological Development Co., Ltd. (Wuhan, China; cat no. K-3001-3) and diethylpyrocarbonate was purchased from Gibco (Thermo Fisher Scientific, Inc., Waltham, MA, USA).
8
Isolation and Characterization of I. obliquus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
I. obliquus was obtained from the Microbial Genetic Stock Center of Huazhong Agricultural University (Wuhan, China). DEAE cellulose-52, Sephadex G-100, and T-series dextran molecular weight standards (T-10, T-40, T-70, T-500, T-2000) were from Pharmacia (Sweden). D-glucose (Glc), D-mannose (Man), D-arabinose (Ara), D-xylose (Xyl), D-fucose (Fuc), L-rhamnose (Rha), inositol, and erythritol (purity of standards ≥99%) were from Sigma-Aldrich (USA). DMEM, RPMI-1640, trypsin, penicillin-streptomycin, and diethyl pyrocarbonate (DEPC)-treated water were from Gibco (USA). High-Capacity cDNA Reverse Transcription Kit was from Thermo Fisher Scientific (USA). HiPure Fungal RNA Mini Kit was from Megen (China). HiScript II Q RT SuperMix for qPCR Kit was from Vazyme (China). Cell Counting Kit-8 (CCK-8 Kit) was from Beyotime Institute of Biotechnology (China). Concanavalin A (ConA) and camptothecin (CPT) were from Macklin Biochemical Co.(China) Macrophage RAW264.7, human cervical cancer HeLa, and mouse sarcoma S180 cell lines were from American Type Culture Collection (ATCC; USA). RAW264.7 was cultured with 10% FBS and 1% double-strength RPMI-1640, and HeLa and S180 were cultured with 10% FBS and 1% DMEM, for 2 days at 37°C in 5% CO2 atmosphere. Other reagents were from Sinopharm Chemical Reagent Co. (China).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!