All PCRs were conducted by the same technician. Fluorescently labeled PCR primers were used to amplify 5 loci with variable-length tandem repeats; a new reverse primer was used for VCA0283 (5′-AGCCTCCTCAGAAGTTGAG-3′ ) (13 (link)). The reaction products were separated, detected, and sized by using a 3730xl automatic sequencer, internal lane standards (Liz600), and GeneScan program (all from Applied Biosystems). Genotypes were determined by using published formulas to calculate the number of repeats from the length of each allele except for VC0437, which is calculated by (x – 252)/7 (13 (link)). Five loci were ordered: VC0147, VC0437, VC1650, VCA0171, and VCA0283. A genotype (e.g., 9-4-6-19-11) was interpreted as an isolate having alleles of 9, 4, 6, 19, and 11 repeats at the 5 loci, respectively. Relatedness of isolates was assessed by using eBURST version 3 (http://eburst.mlst.net ). Genetically related genotypes are defined as those possessing identical alleles at 4 of the 5 loci and groups of related genotypes (clonal complexes). Additional sensitivity analyses were conducted by using only the 3 more stable loci from the large chromosome (VC0147, VC0437, VC1650); relatedness was determined by identical alleles at 2 of the 3 loci (13 (link),21 (link)).
3730 xl automatic sequencer
Manufactured by Thermo Fisher Scientific
Sourced in United States
The 3730 xl Automatic Sequencer is a high-performance genetic analysis instrument designed for DNA sequencing applications. It features a fully automated, 96-well sample processing platform that enables efficient and reliable DNA sequence data generation. The core function of this product is to automate the process of DNA sequencing, providing researchers with accurate and reproducible results.
Automatically generated - may contain errors
Lab products found in correlation
Genescan program, by Thermo Fisher Scientific (4 mentions)
Bigdye terminator v3.1 cycle sequencing kit, by Thermo Fisher Scientific (4 mentions)
Liz600, by Thermo Fisher Scientific (2 mentions)
Agilent 6340 ion trap, by Agilent Technologies (2 mentions)
Agilent 6520 accurate mass quadrupole time of flight, by Agilent Technologies (2 mentions)
Agilent 1260 infinity, by Agilent Technologies (2 mentions)
Agilent 1100 hplc system, by Agilent Technologies (2 mentions)
Ltq orbitrap xl, by Waters Corporation (2 mentions)
Bigdye terminator v1.1 cycle, by Thermo Fisher Scientific (1 mentions)
Dneasy blood tissue kit, by Qiagen (1 mentions)
Dreamtaq dna polymerase, by Thermo Fisher Scientific (1 mentions)
Dreamtaq green buffer, by Thermo Fisher Scientific (1 mentions)
Qiaquick pcr purification kit, by Qiagen (1 mentions)
Dneasy plant mini kit, by Qiagen (1 mentions)
Cleanup standard kit, by Evrogen (1 mentions)
15 protocols using 3730 xl automatic sequencer
1
Multilocus VNTR Analysis for Vibrio cholerae
2
Biological Relationship Confirmation via STR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Short tandem repeats were used to confirm the biological relationships between probands and their parents. Each forward primer was labeled with FAM fluorescence. Touch-down PCR was used with the following thermal cycling conditions: 94°C for 5 min, 94°C for 30 s, 64°C for 30 s, and 72°C for 45 s, and the annealing temperature reduced 1°C every 2 cycles (from 64 to 58°C), 26 cycles at the final annealing temperature of 58°C, with a final extension at 72°C for 10 min, and termination at 4°C. The amplification products were detected using a 3730XL automatic sequencer (Applied Biosystems).
3
Screening Klebsiella Pneumoniae Resistance Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We screened Kp strains for genes encoding extended-spectrum β-lactamases (ESBLs) (blaCTX-M-1-, blaCTX-M-9-, blaTEM-, and blaSHV-type), carbapenemases (blaIMP-1-type, blaVIM-2-type, blaNDM, blaKPC, blaKPC-2, blaGES, and blaOXA-48-like) [15 (link)], and outer membrane proteins (ompK35 and ompK36) using PCR (Verity 96-Well; Applied Biosystems, Eatate, Singapore) [16 (link)]. The PCR products were sequenced using a 3730xl automatic sequencer (Applied Biosystems, Weiterstadt, Germany), and the nucleotide sequences were compared using the Basic Local Alignment Search Tool (https://blast.ncbi.nlm.nih.gov/Blast.cgi ) (Supplemental Data Table S1 ).
4
Multilocus Variable-number Tandem-repeat Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was genotyped for five MLVA loci: VC0147, VC0436-7 (intergenic), VC1650, VCA0171 and VCA0283 [18 (link)]. Each of the five loci was amplified as described previously [17 (link),18 (link)]. The presence of amplified products was confirmed by gel electrophoresis.
The fluorescently labeled amplified products were separated using a 3730xl Automatic Sequencer with the size determined from internal lane standards (LIZ600) by the GeneScan program (Applied Biosystems, Foster City, CA). The genotypes for each isolate are in supplementary table 1 (S1 Table ) EBURST (www.mlst.net ) was used to define the genetic relatedness between genotypes. Genotypes within a clonal complex were related by a series of single locus variants.
The fluorescently labeled amplified products were separated using a 3730xl Automatic Sequencer with the size determined from internal lane standards (LIZ600) by the GeneScan program (Applied Biosystems, Foster City, CA). The genotypes for each isolate are in supplementary table 1 (
5
Vibrio cholerae Genotyping by MLVA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Five loci (VC0147, VC0436-7, VC1650, VCA0171, and VCA0283) containing a variable number of tandem repeats were amplified using specific primers [1 (link)]. These PCR products were separated, detected, and sized by using a 3730xl automatic sequencer using internal lane standards (Liz 600), and the Gene Scan program (all from Applied Biosystems, Foster City, CA, USA). Genotypes were determined using published formulas to calculate the number of repeats from the length of each allele [1 (link)]. Five loci were ordered by their chromosomal location and a genotype (e.g., 9, 4, 14, 22, 17) was interpreted as an isolate having alleles of 9, 4, 14, 22, and 17 repeats at the 5 loci, respectively. The relatedness of isolates was assessed by using eBURST version 3 (http://eburst.mlst.net ) [1 (link), 4 (link)]. Genetically-related genotypes are defined as those possessing identical alleles at 4 of the 5 loci; groups of related genotypes are called MLVA clonal complexes (CCs).
6
MLVA Typing of Bacterial Isolates
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Sanger-derived MLVA typing was performed by sequencing amplicons on both strands on the ABI 3130 GA, using the BigDye Terminator v1.1 cycle sequencing kit (Applied Biosystems, USA). Motif repeats were counted manually and translated into MLVA profiles. For Ugandan isolates, the fluorescently labeled amplified products were separated using a 3730xl Automatic Sequencer with the size determined from internal lane standards (LIZ600) by the GeneScan program (Applied Biosystems, Foster City, CA).
When MLVA profiles were generated according to the method proposed by Kendall et al. [10 (link)], the formula had to be modified to better fit the sequence length of the motif and the position of the primers (Table 1 ). It is of note that, the original calculation formula was used for the VCA0283 locus but with a modified reverse primer (AGCCTCCTCAGAAGTTGAG instead of the original reverse primer [GTACATTCACAATTTGCTCACC]). It is worth nothing that using the original reverse primer would require to adapt the formula.
When MLVA profiles were generated according to the method proposed by Kendall et al. [10 (link)], the formula had to be modified to better fit the sequence length of the motif and the position of the primers (
7
DNA Extraction and Sequencing Procedure
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was isolated with QIAGEN DNeasy Blood & Tissue kit from silica-dried or fresh leaves. Primers used for amplification and sequencing were listed in Table S3 . Sequencing reactions were performed in the Applied Biosystems 3730xl automatic sequencer and edited with the Geneious 5.5.3 software.
8
Splicing Defect Identification by PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Five pairs of primers were designed to amplify the resulting cDNA by PCR (Table 1 ). The PCR parameters were optimised as follows: 94°C for 5 min, 35 cycles of denaturation (94°C for 30 s), annealing (58°C for 30 s), and elongation (72°C for 45 s), and a final elongation at 72°C for 7 min. The amplification products were separated by 2% agarose gel electrophoresis and sequenced using a 3730XL automatic sequencer (Applied Biosystems).
Splicing defects were determined according to agarose gel image patterns of the amplification products containing the wild-type and variant alleles. The criteria were based on those proposed by Aoto et al. (9 (link)).
Splicing defects were determined according to agarose gel image patterns of the amplification products containing the wild-type and variant alleles. The criteria were based on those proposed by Aoto et al. (9 (link)).
9
Molecular Detection of Canine Pathogens
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Polymerase chain reaction (PCR) was performed to detect the 16S rDNA and the gltA genes of E. canis and A. platys. All PCR reactions were prepared in 50 µL total volume in a 0.2 mL PCR tube, with each reaction containing 1X DreamTaq Green buffer (Thermo Scientific), 0.2 mM dNTP, 1 µM PCR primer, 1.25 units of DreamTaq DNA polymerase (Thermo Scientific), and 2 µL of DNA sample. The PCR conditions were as follows: All amplifications involved initial denaturation at 95°C for 2 min, 40 cycles of denaturation at 95°C for 30 s, annealing at 57°C for 30 s (for E. canis 16S rDNA), 54°C for 30 s (for E. canis gltA and A. platys16S rDNA), or 58°C for 30 s (for A. platys gltA) followed by the extension step at 72°C for 30 s. Then, all amplifications were completed with a final extension at 72°C for 5 min. The PCR products were resolved on a 2% agarose gel with DNA gel stain to identify predicted amplicons using the gel documentation system. All positive PCR amplicons were purified using a commercial gel extraction kit (Geneaid®) according to the manufacturer’s instructions and quantified using a Nanodrop spectrophotometry. Polymerase chain reaction products were sequenced from both ends using the Sanger method with a 3730XL automatic sequencer (Applied Biosystems, Foster City, CA, USA).
10
Fungal DNA Extraction and Amplification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For DNA extraction we used either the standard CTAB protocol (Griffith and Shaw 1998 (link)) or DNeasy Plant Mini kit (Qiagen, Hilden, Germany). Primers ITS1F (Gardes and Bruns 1993 (link)), ITS4 (White et al. 1990 (link)) and LR21 (Hopple and Vilgalys 1999 (link)) were used to amplify the internal transcribed spacers 1 and 2 and the 5.8S gene. LR0R, LR5 (Moncalvo et al. 2002 (link)) and LR7 (Hopple and Vilgalys 1999 (link)) were used to amplify 28S large ribosomal subunit. Polymerase chain reaction (PCR ) products were purified with the Cleanup Standard kit (Evrogen Ltd, Moscow, Russia) or QIAquick PCR purification kit (Qiagen, Hilden, Germany). Sequencing reactions were performed either by the Evrogen company (Moscow, Russia) following the BigDye terminator protocol (ABI Prism) on an Applied Biosystems 3730 xl automatic sequencer (Applied Biosystems, CA, USA) with primers ITS1F and ITS4 or with an external service provided by Macrogen (South Korea) using primers ITS1, ITS4, CTB6 (http://plantbio.berkeley.edu/~bruns/ ), LR5 and LR3R (Hopple and Vilgalys 1999 (link)).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!