Hiscript 2 q select rt supermix kit

Total RNA was extracted from infected EBL cells using the TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions, and the RNA concentration was assessed using NanoDrop 2000 (Thermo Fisher Scientific). Next, the RNA was reverse-transcribed into cDNA using a HiScript II Q Select RT SuperMix kit (Vazyme) according to the manufacturer’s instructions. Each cDNA sample was analyzed in triplicate using qPCR. PCR amplification was performed using the ABI ViiA 7 Real-Time PCR system (Applied Biosystems, Carlsbad, CA, USA) by using GAPDH as the internal control. The primer sequences are presented (Table 1). The relative gene expression levels were determined by referring to the 2^−ΔΔCT calculation method. Each treatment was carried out in three repeats, and all experiments were performed independently three times.

The total RNA was extracted from the hippocampus brain area with Trizol reagents (Qiyun Biotechnology Co., Ltd., Guangzhou, China), following the manufacturer’s protocol. The concentration of RNA was quantified by ultraviolet spectrophotometry (DeNovix Co., Ltd., Delaware, America) at 260/280 nm. Complementary DNA (cDNA) was synthesized from 1 μg total RNA using the HiScript ^® II Q Select RT SuperMix kit (Vazyme Biotech Co., Ltd., Nanjing, China). PCR amplifications were performed on a ABI7500 Real-Time PCR Detection System (Thermo Fisher Scientific Co., Ltd., Shanghai, China) using the SYBR qPCR Master Mix kit (Vazyme Biotech Co., Ltd., Nanjing, China) under the following conditions: initial activation at 95 °C for 30 s, followed by 40 cycles of amplification (95 °C for 5 s, 60 °C for 30 s) [48 (link)]. The fold change was calculated using the 2-ddCt method, normalized against the internal control, GAPDH. The primer sequences for the target genes and GAPDH are listed in Table 2.

For each Q-PCR sample, at least 10 larvae were collected as a pool. The total RNA of each sample was isolated using TRIzol reagent (Thermo Fisher, USA), and then the cDNA was generated using a HiScript II Q Select RT SuperMix kit (Vazyme, China) according to the manufacturer’s instructions. Three samples were applied in each Q-PCR group. Q-PCR was performed using a SYBR Green PCR Core Reagent kit on a LightCycler 96 system (Roche, Switzerland). Fold changes were determined by the ΔΔ comparative threshold method. Primers are detailed in Table S1.
In addition, for WT and ripk3-deficient larvae, a common Q-PCR forward primer (co_FP) and a reverse primer (RP) were designed to detect the expression of ripk3. On the other hand, a WT-specific forward primer (wt_FP) and a mutant-specific forward primer (mut_FP) were respectively designed to detect the expression of WT or mutant form of ripk3 mRNA.

miRNA and mRNA expression levels were analyzed by qRT-PCR as described previously [50 (link)]. Briefly, by using the HiScript II Q Select RT SuperMix kit (Vazyme, Nanjing, China) to reverse transcribe RNA (1 μg) into cDNA. For miRNA, using a miRNA 1st-Strand cDNA Synthesis Kit (GeneCopoeia, Carlsbad, CA, USA) to synthesize cDNA. qRT-PCR were performed with AceQ qPCR SYBR Green Master Mix (Vazyme) in ABI ViiA 7 (Applied Biosystems, Carlsbad, CA, USA). Meanwhile, U6 and β-actin acted as the internal reference, respectively. The 2^−ΔΔCt method was adopted to analyze the genes relative expression. Table S2 displayed the related primer sequences.

To quantify miR-9 in cells or tissues, total RNA was purified using an Eastep Super total RNA extraction kit (catalogue no. LS1040m, Promega) following the manufacturer’s protocol for retaining small RNA, reverse transcribed using a miRNA 1st Strand cDNA Synthesis Kit (catalogue no. MR101-01, Vazyme Biotech), and PCR amplified using a ChamQ Universal SYBR qPCR kit (catalogue no. Q711-02/03; Vazyme Biotech). The stem-loop primers and qPCR primers for miR-9 quantification were purchased from RiboBio. To quantify transcripts, RNA was isolated using an Eastep Super total RNA extraction kit (catalogue no.LS1040m, Promega), reverse transcribed using a HiScript II Q Select RT supermix kit (catalogue no. R233-01; Vazyme Biotech), and PCR amplified using a ChamQ Universal SYBR qPCR kit (catalogue no. Q711-02/03; Vazyme Biotech). The analyzed transcript levels were normalized to GAPDH transcript levels. To quantify viral genomes, DNA was isolated using a DNA isolation kit (catalogue no.DC102-01; Vazyme Biotech) and qPCR was conducted using the ChamQ Universal SYBR qPCR kit (catalogue no. Q711-02/03; Vazyme Biotech). Viral genome levels were normalized to mouse Adipsin gene levels. Serially diluted total DNA, total RNA, or synthetic miR-9 was used to generate standard curves. PCR primer sequences are listed in Supplementary Table 4.

Total RNA from cell lines was isolated using TRIzol reagent (Invitrogen). Quantitative RT‐PCR (RT‐qPCR) was performed using HiScript II Q Select RT SuperMix kit (Vazyme) for reverse transcription of total RNA and ChamQ SYBR qPCR Master Mix kit (Vazyme) for real‐time PCR. Real‐time PCR was performed with a LightCycler 480 Instrument (Roche). The primer sequences were listed as follows: ALDH2, forward 5′‐TCAAATTACAGGGTCAACTGCTA‐3′ and reverse 5′‐GCCCCCAACAGACCCCAATC‐3′; GAPDH, forward 5′‐GCATTGCCCTCAACGACCAC‐3′ and reverse 5′‐CCACCACCCTGTTGCTGTAG‐3′; PD‐L1, forward 5′‐TGGCATTTGCTGAACGCATTT‐3′ and reverse 5′‐TGCAGCCAGGTCTAATTGTTTT‐3′.