Log In Sign up
The largest database of trusted experimental protocols

Pan ago clone 2a8

Manufactured by Merck Group
Visit Supplier
Sourced in United States

The Pan-Ago clone 2A8 is a laboratory equipment product designed for specific research applications. It serves as a tool for researchers to perform targeted tasks within their investigations. The core function of this product is to facilitate controlled and precise experimentation, though details on its intended use are not available in this response.

Automatically generated - may contain errors

Lab products found in correlation

Lipofectamine 2000, by Thermo Fisher Scientific (4 mentions) H3k27me3, by Abcam (2 mentions) Quickchip kit, by Novus Biologicals (2 mentions) H3k9me2, by Abcam (2 mentions) Truchip low cell chromatin shearing kit, by Covaris (2 mentions) Hrp labelled secondary antibody, by Cell Signaling Technology (1 mentions) Anti vinculin e1e9v xp, by Cell Signaling Technology (1 mentions) Anti axl c89e7, by Cell Signaling Technology (1 mentions) Anti cd68, by Cell Signaling Technology (1 mentions) Anti alpha tubulin, by Santa Cruz Biotechnology (1 mentions)

3 protocols using pan ago clone 2a8

1

Characterization of miR-211 Chromatin Binding

Cited 2 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
Biotin labeled miR-211 duplexes were generated as previously reported25 . Wild type miR-211 (5′UUCCCUUUGUCAUCCUUUGCCU3′Biotin) and mutant miR-211 5′UUUGUCGAGUCAUCCUUUGCCU3′Biotin) oligos were synthesized from Integrated DNA Technologies (Iowa, US) and transfected into U2OS cell via lipofectamine 2000 (ThermoFisher Scientific, WA). Chromatin was prepared using the truChIP low cell chromatin shearing kit (Covaris) and sheared 200–700 bp fragments. Immunoprecipitation was performed using IgG, pan-Ago clone 2A8 (MABE56 Millipore), H3K27me3 (ab6002 Abcam), H3K9me2 (ab1220, Abcam), RNA polII (ab817 Abcam, ChIP grade CTD repeats) antibodies with a Quick ChIP Kit (Imgenex)22 (link), 32 (link). Primers used for ChIP assays are in supplementary table 2.
Bu Y., Yoshida A., Chitnis N., Altman B.J., Tameire F., Oran A., Gennaro V., Armeson K.E., McMahon S., Wertheim G.B., Van Dang C., Ruggero D., Koumenis C., Fuchs S.Y, & Diehl J.A. (2017). A PERK-miR211 axis suppresses circadian regulators and protein synthesis to promote cancer cell survival. Nature cell biology, 20(1), 104-115.
+ Open protocol
+ Expand
2

Characterization of miR-211 Chromatin Binding

Cited 2 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
Biotin labeled miR-211 duplexes were generated as previously reported25 . Wild type miR-211 (5′UUCCCUUUGUCAUCCUUUGCCU3′Biotin) and mutant miR-211 5′UUUGUCGAGUCAUCCUUUGCCU3′Biotin) oligos were synthesized from Integrated DNA Technologies (Iowa, US) and transfected into U2OS cell via lipofectamine 2000 (ThermoFisher Scientific, WA). Chromatin was prepared using the truChIP low cell chromatin shearing kit (Covaris) and sheared 200–700 bp fragments. Immunoprecipitation was performed using IgG, pan-Ago clone 2A8 (MABE56 Millipore), H3K27me3 (ab6002 Abcam), H3K9me2 (ab1220, Abcam), RNA polII (ab817 Abcam, ChIP grade CTD repeats) antibodies with a Quick ChIP Kit (Imgenex)22 (link), 32 (link). Primers used for ChIP assays are in supplementary table 2.
Bu Y., Yoshida A., Chitnis N., Altman B.J., Tameire F., Oran A., Gennaro V., Armeson K.E., McMahon S., Wertheim G.B., Van Dang C., Ruggero D., Koumenis C., Fuchs S.Y, & Diehl J.A. (2017). A PERK-miR211 axis suppresses circadian regulators and protein synthesis to promote cancer cell survival. Nature cell biology, 20(1), 104-115.
+ Open protocol
+ Expand
3

Cell Lysis and Western Blotting

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were lysed at 4 °C using ice cold lysis buffer containing 30 mM Tris/HCl pH 6.7, 5% glycerol, 2.5% β-mercaptoethanol, and 1% SDS. Protein extracts were analyzed by SDS-PAGE and western blotting. Enhanced chemiluminescence (ECL) signals were detected as described before [38 (link)]. The following antibodies were used for western blot: anti-AXL C89E7 (Cell Signaling Technology, Boston, MA, USA), anti-CD68 (Cell Signaling Technology, Boston, MA, USA), anti-DICER1 clone D38E7 (Cell Signaling Technology, Boston, MA, USA), anti-SPRY4 (GeneTex, Irvine, CA, USA), pan-AGO clone 2A8 (Millipore, Overijse, Belgium), anti-vinculin E1E9V XP (Cell Signalling Technology, Boston, MA, USA), anti-alpha-tubulin (Santa Cruz, Heidelberg, Germany). HRP-labelled secondary antibodies were purchased from Cell Signaling Technology (Boston, MA, USA).
Kozar I., Philippidou D., Margue C., Gay L.A., Renne R, & Kreis S. (2021). Cross-Linking Ligation and Sequencing of Hybrids (qCLASH) Reveals an Unpredicted miRNA Targetome in Melanoma Cells. Cancers, 13(5), 1096.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!