Mycoplasma detection kit

HEK293T (ATCC CRL-3216) cells were obtained from ATCC. Cell lines were examined for mycoplasma contamination using a Mycoplasma Detection Kit (R&D). Primary mouse T cells and human CD14⁺ cells were cultured in RPMI-1640 medium supplemented with 10% fetal calf serum (Invitrogen Life Technology), 10 mM glutamine, 100 U ml⁻¹ penicillin, 100 μg ml⁻¹ streptomycin, and 50 μM 2-mercaptoethanol (referred to as complete RPMI medium). Human Treg cells were cultured in X-VIVO 15 medium with supplements identical to complete RPMI medium (complete X-VIVO15 medium). HEK293T cells were cultured in DMEM medium with the same supplements as for complete RPMI medium.

To measure Ccr5 knockdown efficiency, HEK 293 cells were co-transfected with CCR5-tdTomato plus either shRNA-CCR5 or shRNA-Cont (dsRed) plasmids. HEK293 cells were ordered from ATCC (CRL-1573) and were tested with Mycoplasma Detection Kit (R&D Systems, CUL001B) to make sure there was no contamination. One day after plasmid transfection, cells were imaged to examine the effect of shRNA-CCR5 on CCR5-tdTomato expression. Ccr5 knockdown efficiency was also tested by measuring Ccr5 mRNA expression in the hippocampus one month after the injection of AAV containing shRNA-cont or shRNA-CCR5. To measure Ccr5 mRNA expression, tissue samples were collected from the dorsal hippocampus and total RNA was extracted by RNeasy Mini Kit (Qiagen, Valencia, CA, USA) and treated with DNase (Qiagen). Total RNA was first reverse-transcribed into cDNA using oligo (dT) primers and Superscipt III First-Strand Synthesis System (Invitrogen, Carlsbad, CA, USA), and was then quantified by qPCR. The following primer sequences were used for the Ccr5 qPCR: 5’GCTGCCTAAACCCTGTCATC 3’(forward) and 5’GTTCTCCTGTGGATCG GGTA3’ (reverse). The ribosome protein RPL13A was used as a housekeeping control.

Human keratinocytes (HaCaT) were maintained in Dulbecco’s modified Eagle medium (DMEM; GIBCO) base medium supplemented with 10% (v/v) fetal bovine serum and 0.5% (v/v) antibiotic–antimycotic solution (GIBCO). The cells were obtained from the laboratory of Dr. NE Fusenig, Germany. The cells were checked for mycoplasma contamination using mycoplasma detection kit (R&D). In case of any contamination, mycoplasma removal agent Plasmocin (Invivogen) was used.

HEK293T (ATCC CRL-3216), HT-29 (ATCC HTB-38), J774A.1 (ATCC TIB-67) and Jurkat T lymphoma (clone E6-1, ATCC TIB-152) and L929 (ATCC CCL-1) cell lines were obtained from ATCC. Cell lines were examined for mycoplasma contamination using a Mycoplasma Detection Kit (R&D). HT-29 cells and Jurkat cells were cultured in complete RPMI-1640 medium containing 10% fetal calf serum (Invitrogen Life Technology), 10 mM glutamine, 100 U/ml penicillin, 100 μg/ml streptomycin and 50 μM 2-mercaptoethanol. HEK293T, J774A.1 and L929 cells were cultured in complete DMEM medium with the same supplements as for complete RPMI medium. Bone marrow cells were collected from tibias and femurs by flushing with cold phosphate buffered saline (PBS). Bone marrow cells were cultured in complete DMEM medium with 20% L929-conditioned media for 6 days to generate bone marrow-derived macrophages (BMDMs). Bone marrow cells were also differentiated in complete RPMI medium containing 20 ng/ml GM-CSF for 8 days to generate bone marrow-derived dendritic cells (BMDCs). DAPK was also knocked down in HT-29 cells by transfection with siDAPK1 using Lipofectamine 2000.

LuM-1, a highly metastatic sub-clone of murine colon cancer, colon26^{63 (link)} was kindly obtained from Dr. Oguri, Aichi Cancer Center, Japan, and maintained in RPMI supplemented with 10% FCS, 100 U/mL penicillin and 100 μg/mL streptomycin (Sigma-Aldrich, St. Louis, MO, USA). After achieving > 80% confluence, cells were removed by treatment with TrypLE Express(Gibco), and then used for experiments. Cultured cells were tested using the Mycoplasma Detection Kit (R&D Systems, Minneapolis, MN, USA) every 3 months and used for experiments after three passages.

Fh1-deficient cells (uok262) and Fh1-proficient cells (pFH) were kindly provided by Prof. Liang Zheng [15 (link)]. All cell lines were cultured using DMEM (Hyclone, Cat# SH30081) supplemented with 10% heat-inactivated serum (Gibco, Cat# 16170078) and 2 mM glutamine (Gibco, Cat# 25030149) and 1 mM pyruvate (Gibco, Cat# 11360070) and were regularly tested to ensure they were mycoplasma free using a mycoplasma detection kit (R&D, Cat# CUL001B). The other renal tumor cell lines such as 786-O, 769-p, ACHN and CAKI-1, and the normal renal tubular epithelial cell line HK2 were purchased from American Type Culture Collection (ATCC, Manassas, VA, USA). ACHN cell line was cultured in MEM media with 10% heat-inactivated serum, and other cell lines were cultured with 1640 media contained 10% heat-inactivated serum. All cell lines were maintained at 37 °C with 5% CO₂.