Rna bee kit

RNA was extracted from C. jejuni wild-type grown in HI with or without 25 mM serine, aspartate, fumarate or succinate under 10 or 0.3% oxygen concentration at logarithmic (10 h) or stationary phase (20 h). RNA was also extracted from the wild-type, the racR mutant and the racR complemented strain grown in HI with 50 mM of NaNO₃ under 0.3% oxygen concentration until late logarithmic (log) phase (16 h) using the RNA-Bee™ kit (Tel-Test, Inc.). RNA samples were treated with RNAse-free DNAse I (Fermentas) according to the manufacturer's manual.

After purging the ovarian tissue was manually cut into small, approximately 1 mm³ fragments using a scalpel. Total RNA was isolated from these fragments using the RNA Bee kit (Tel-Test Inc., Friendswood, TX, USA). RNA was quantified using the NanoDrop 2000 spectrophotometer (Thermo Scientific, Breda, The Netherlands). First strand cDNA was synthesized by Superscript II (Invitrogen, Waltham, MA, USA) from 1 µg of total RNA using random hexamer primers (Promega, Madison, WI, USA) in 40 µL. PCR reactions were performed in 25 µL containing 2 µL of cDNA and 5 pmol of each forward and reverse primer. Primer sequences for the amplification of the EWS-FLI1 fusion transcript were 5′TCCTACAGCCAAGCTCCAAGTC3′ and 5′CTGGAGAGCGAGGTGGCTTC3′ (forward primers in exons 7 and 9 of the EWS gene) and 5′CTGATCGTTTGTGCCCCTCC3′ (reverse primer in exon 7 of the FLI1 gene). PCR was run in a T100 thermocycler (Biorad, Lunteren, The Netherlands) for 10 min at 95 °C, followed by 35 cycles of 92 °C for 1 min (denaturation), 65 °C for 1 min (annealing) and 2 min at 72 °C (extension). The HBMS control transcript was RT-PCR amplified with primers 5′TGCCAGAGAAGAGTGTGGTG3′ and 5′ATGATGGCACTGAACTCCTG3′ using the same program but with an annealing temperature of 60 °C. PCR products were run on a standard 1.5% agarose gel and photographed.