The largest database of trusted experimental protocols

5 protocols using control rabbit igg antibody

1

ChIP-qPCR Profiling of CHOP Binding

Check if the same lab product or an alternative is used in the 5 most similar protocols
ChIP with rabbit anti-CHOP (Cell Signaling Technologies) and control IgG rabbit antibody (Cell Signaling Technologies) was performed in Xbp1 and control silenced MODE-K cells by using a SimpleChIP Plus Enzymatic ChIP kit (Cell Signaling Technologies). Immunoprecipitated DNA was subject to qPCR to determine enrichment of CHOP binding to respective promoters (–431 to –272 bp relative to the start codon of Ulbp1), and results were normalized to input chromatin DNA. Primers used for qPCR were as follows: forward, 5′-TGTAGATCACCCTACCCAGCCT-3′ and reverse, 5′-TAAGAAGGACTCGAAGTGCAGGA-3′.
+ Open protocol
+ Expand
2

Chromatin Immunoprecipitation and Western Blot Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Antibodies against c-MYC, FOSL1 and GLI2 were purchased from Cell Signaling, HMGA2 antibody was from Biocheck Inc, while vimentin and BRD4 antibodies were from Abcam. ZEB1, α-tubulin and total FAK antibodies were obtained from Santa Cruz, while E-cadherin antibody was from Invitrogen. pFAK(Y397) antibody was from BD Transduction laboratories, while GAPDH and α2- and β1-integrin antibodies were from Millipore. Secondary antibodies were purchased from Sigma. The EZ-Chip and EZ-Zyme Chromatin Prep kits were from Millipore. The anti-GLI2 rabbit antibody for ChIP assay was purchased from Abcam, while the control IgG rabbit antibody was from Cell Signaling. BET inhibitor JQ1 was obtained from BPS Bioscience, while I-BET151 was acquired from Tocris Bioscience. BRD4, c-MYC, FOSL1, ZEB1 and GLI2 siRNAs were purchased from Life Technologies.
+ Open protocol
+ Expand
3

Chromatin Immunoprecipitation (ChIP) Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
Chromatin immunoprecipitation (ChIP) was performed using the ChIP-IT® Express Enzymatic
Kit (Active Motif, #53009, Carlsbad, CA, USA).
HSSYII and SYO-1 cells were grown to confluence in 15 cm dishes. Chromatin was cross-linked using 1% formaldehyde for 10 min, followed by glycine solution for 5 min to stop the reaction. Cells were then scraped into ice-cold PBS containing PMSF and centrifuged before incubation in lysis buffer for 45 min. Cells were then physically homogenized on ice to obtain nuclear lysates, which were incubated with digestion buffer for 5 min at 37°C, followed by incubation with the provided Enzymatic Shearing Cocktail for an optimized timepoint. Fifty microliters of the sheared lysate was used to confirm shearing efficiency and quantify DNA concentration. Ten micrograms of chromatin from each cell line was immunoprecipitated with either 2 µg of SS18-SSX antibody or control rabbit IgG antibody (Cell Signaling Technology, #2729, Danvers, MA, USA). Chromatin was then subjected to reverse cross-linking and proteinase K treatment, and subsequently stored at −20°C before qPCR assays.
+ Open protocol
+ Expand
4

ChIP-qPCR for MMP-9 Promoter Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
ChIP was conducted as previously reported [19 (link)]. Briefly, cells were cross-linked (using 1% formaldehyde) and lysed (in ChIP lysis buffer: HEPES-KCl 50 mM, pH 7.5; NaCl 140mM; EDTA 1mM; Triton X-100 1%; sodium deoxycholate 0.1% and SDS 0.1%). They were then sonicated for the shearing of chromatin into smaller (200-500-bp) fragments. The generated fragments were then immunoprecipitated with either control rabbit IgG antibody (Cell Signaling) or ChIP-grade antibody (anti-STAT3; Millipore), and incubated with protein G agarose beads (Roche Applied Science). This was followed by reversal of cross-linking by Proteinase K treatment, and recovery of DNA. SYBR green dye (QIAGEN, Valencia, CA) was used to quantitate PCR products. Primers used for MMP-9 gene promoter were: 5’-tggggaggatatctgacctg-3’/5’-ttgcaaactgcagagcttgt-3’.
+ Open protocol
+ Expand
5

ChIP Assay for STAT3 Binding to PD-L1 Promoter

Check if the same lab product or an alternative is used in the 5 most similar protocols
The chromatin immunoprecipitation (ChIP) assay was manipulated using SimpleChIP Plus Sonication Chromatin IP Kit following manufacturer's protocol (#56383, Cell Signaling, USA). Crosslinked chromatin was immunoprecipitated with anti pSTAT3 rabbit antibody or control rabbit IgG antibody (Cell Signaling, USA). qPCR was performed to quantitative analysis of precipitated DNA. The primers of CD274 (PD‐L1) promoter were as follows: forward primer, 5′‐CAAGGTGCGTTCAGATGTTG‐3′ and reverse primer, 5′‐ GGCGTTGGACTTTCCTGA‐3′.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!