Cas9 nuclease solution

Manufactured by Thermo Fisher Scientific

Sourced in United States

Cas9 nuclease solution is a laboratory reagent used in genome editing applications. It contains the Cas9 protein, a key component of the CRISPR-Cas9 system, which functions as a programmable DNA endonuclease that can be used to precisely target and cleave specific DNA sequences.

Automatically generated - may contain errors

Lab products found in correlation

Tracrrna, by Merck Group (4 mentions) Crrna, by Merck Group (3 mentions) Genotyping primers, by Ajinomoto Group (3 mentions) Nepa21 electroporator, by Nepa Gene (2 mentions) Femtojet 4i, by Eppendorf (1 mentions)

Spelling variants of this product

Cas9 nuclease (11 citations)

4 protocols using cas9 nuclease solution

Generation of Cfap97d1 Mutant Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols

Pronuclear injection and electroporation were performed to introduce gRNA/Cas9 RNP as previously described [20 ]. Briefly, a gRNA solution was prepared by annealing crRNA (target genome sequence: 5’-AGGTGGACTGCTGGAATGAG -3' and 5’- CTTCGACTCCCACAAAGCCT -3'; Sigma-Aldrich) and tracrRNA (Sigma-Aldrich). Then, two gRNA solutions (gRNA1 and gRNA2) and Cas9 nuclease solution (Thermo Fisher Scientific) were mixed. The final concentrations of gRNA and Cas9 were as follows: for pronuclear injection, 20 ng/μL gRNA1, 20 ng/μL gRNA2, and 54 ng/μL Cas9 nuclease; for electroporation, 20 ng/μL gRNA1, 20 ng/μL gRNA2, and 100 ng/μL Cas9 nuclease.
The gRNA/Cas9 RNPs introduced embryos (B6D2F1) were transplanted into the oviduct ampulla of pseudopregnant mice (ICR; 10 embryos per ampulla) on the following day. After 19 days, pups were delivered through Caesarean section and placed with foster mothers (ICR). To generate Cfap97d1 heterozygous mutant mice, F0 mice were mated with WT B6D2F1. Mouse colonies with a 3168 bp deletion (referred to as Cfap97d1^em1) were maintained by sibling mating and used for the phenotype analysis. The genotyping primers are available in S1 Table. Frozen sperm from Cfap97d1 heterozygous mutants (B6D2-Cfap97d1 , RBRC#10805, CARD#2785) are available through RIKEN BRC (http://en.brc.riken.jp/index.shtml) and CARD R-BASE (http://cardb.cc.kumamoto-u.ac.jp/transgenic/).

Oura S., Kazi S., Savolainen A., Nozawa K., Castañeda J., Yu Z., Miyata H., Matzuk R.M., Hansen J.N., Wachten D., Matzuk M.M, & Prunskaite-Hyyryläinen R. (2020). Cfap97d1 is important for flagellar axoneme maintenance and male mouse fertility. PLoS Genetics, 16(8), e1008954.

+ Open protocol

+ Expand

Generation of ΔRING-Trim41 Mutant Mice

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

ΔRING-Trim41 mice were generated by microinjection described previously [49 (link)]. First, a gRNA solution was prepared by annealing two tra crRNAs (Sigma-Aldrich, St. Louis, MO, USA) and crRNA (Sigma-Aldrich). The target genomic sequences are listed in S1 Table Then, the gRNA solution and Cas9 nuclease solution (Thermo Fisher Scientific, Waltham, MA, USA) were mixed: 40 ng/μL gRNA each and 108 ng/μL Cas9 nucleases. The obtained complex was then microinjected into fertilized eggs (B6D2F1) using a programmable microinjector (FemtoJet 4i, Eppendorf, Hamburg, Germany). The microinjected eggs were then transplanted into the oviduct ampulla of pseudopregnant mice (ICR) on the following day. After 19 days, pups were delivered through Caesarean section and placed with foster mothers (ICR). To generate heterozygous mutant mice, F0 mice were mated with WT B6D2F1. Mouse colonies with the desired mutation were maintained by sibling matings. The genotyping primers (GeneDesign) are listed in S1 Table The mutant mouse line is available from Riken BRC (#11041) and CARD (#2948).

Oura S., Hino T., Satoh T., Noda T., Koyano T., Isotani A., Matsuyama M., Akira S., Ishiguro K.I, & Ikawa M. (2022). Trim41 is required to regulate chromosome axis protein dynamics and meiosis in male mice. PLoS Genetics, 18(6), e1010241.

+ Open protocol

+ Expand

Generation of Kctd19 Knockout Mice

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Kctd19 deletion mice and Kctd19-ΔPOZ/TAZ mice were generated by electroporation described previously [43 (link),44 (link)]. Briefly, a gRNA solution was prepared by annealing two tra crRNAs (Sigma-Aldrich, St. Louis, MO, USA) and crRNA (Sigma-Aldrich). The target genomic sequences are listed in S1 Table. Then, the gRNA solution and Cas9 nuclease solution (Thermo Fisher Scientific, Waltham, MA, USA) were mixed. The final concentrations of gRNA and Cas9 were as follows: for pronuclear injection, 20 ng/μL gRNA, and 100 ng/μL Cas9 nucleases. The obtained complex was electroporated into fertilized eggs using a NEPA21 electroporator (NEPA GENE, Chiba, Japan). The electroporated eggs were transplanted into the oviduct ampulla of pseudopregnant mice (ICR; 10 embryos per ampulla) on the following day. After 19 days, pups were delivered through Caesarean section and placed with foster mothers (ICR). To generate heterozygous mutant mice, F0 mice were mated with WT B6D2F1. Mouse colonies with a 9612 bp deletion and a 2172 bp deletion were maintained by sibling mating and used for the phenotype analysis of Kctd19 deletion and Kctd19-ΔPOZ, respectively. The genotyping primers (GeneDesign, Osaka, Japan) and amplification conditions are available in S1 Table.

Oura S., Koyano T., Kodera C., Horisawa-Takada Y., Matsuyama M., Ishiguro K.I, & Ikawa M. (2021). KCTD19 and its associated protein ZFP541 are independently essential for meiosis in male mice. PLoS Genetics, 17(5), e1009412.

+ Open protocol

+ Expand

Generation of Kctd19 Knockout Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols

Kctd19 deletion mice and Kctd19-ΔPOZ/TAZ mice were generated by electroporation described previously (42, 43) . Briefly, a gRNA solution was prepared by annealing two tra crRNAs (Sigma-Aldrich, St. Louis, MO, USA) and crRNA (Sigma-Aldrich). The target genomic sequences are listed in Table S1. Then, the gRNA solution and Cas9 nuclease solution (Thermo Fisher Scientific, Waltham, MA, USA) were mixed. The final concentrations of gRNA and Cas9 were as follows: for pronuclear injection, 20 ng/µL gRNA, and 100 ng/µL Cas9 nucleases. The obtained complex was electroporated into fertilized eggs using a NEPA21 electroporator (NEPA GENE, Chiba, Japan). The electroporated eggs were transplanted into the oviduct ampulla of pseudopregnant mice (ICR; 10 embryos per ampulla) on the following day. After 19 days, pups were delivered through Caesarean section and placed with foster mothers (ICR). To generate heterozygous mutant mice, F0 mice were mated with WT B6D2F1. Mouse colonies with a 9612 bp deletion and a 2172 bp deletion were maintained by sibling mating and used for the phenotype analysis of Kctd19 deletion and Kctd19-ΔPOZ, respectively. The genotyping primers (GeneDesign, Osaka, Japan) and amplification conditions are available in Table S1.

Oura S., Koyano T., Kodera C., Takada-Horisawa Y., Matsuyama M., Ishiguro K., & Ikawa M. (2021). KCTD19 associates with ZFP541 and HDAC1 and is required for meiotic exit in male mice.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!