Recombinant human tPA (Actilyse®) was purchased from Boehringer Ingelheim (Ingelheim am Rhein, Germany). Fetal bovine serum, horse serum, lipofectamine R 2000 reagent, B27 supplement, glutamine, laminin, neurobasal medium, and penicillin/streptomycin were purchased from ThermoFisher (Waltham, Massachusetts, USA). Dulbecco’s modified Eagle’s medium (DMEM), poly-D-lysine, phosphate-buffered saline (PBS), Glycine (Gly), paraformaldehyde, albumin from bovine serum, ammonium chloride (NH4Cl), potassium chloride (KCl), and rabbit polyclonal antibody were purchased from Sigma-Aldrich (St Louis, MO, USA). Tetrodotoxin citrate (TTX), cyanquixaline (CNQX), (2R)-amino-5-phosphonovaleric acid (APV) and bicuculline methiodide (Bic) were purchased from Tocris (Bristol, UK). HaloTag® TMR ligand was purchased from Promega (Madison, Wisconsin, USA). The following primary antibodies were used for immunocytochemistry: mouse monoclonal anti-HaloTag® (dilution 1:1,000; Promega; G9211) rabbit anti-tPA polyclonal antibody (dilution 1:1 500; generous gift from R. Lijnen, Leuven), chicken anti-Microtubule-associated protein 2 (MAP2) polyclonal antibody (dilution 1:8 000; Abcam, Cambridge, UK; ab5392). Secondary fluorescent antibodies (Alexa647; dilution 1:800) were purchased from Jackson Immunoresearch (Bar Harbor, ME, USA).
Lipofectamine r 2000 reagent
Manufactured by Thermo Fisher Scientific
Sourced in United States
Lipofectamine R 2000 reagent is a cationic lipid-based transfection reagent used for the delivery of nucleic acids, such as plasmid DNA, siRNA, and mRNA, into eukaryotic cells. It facilitates the uptake of these molecules by the cells, enabling efficient gene expression or gene silencing studies.
Automatically generated - may contain errors
Lab products found in correlation
Fetal bovine serum (fbs), by Thermo Fisher Scientific (2 mentions)
Neurobasal medium, by Thermo Fisher Scientific (2 mentions)
Penicillin streptomycin, by Thermo Fisher Scientific (2 mentions)
B27 supplement, by Thermo Fisher Scientific (2 mentions)
Rabbit polyclonal antibody, by Merck Group (1 mentions)
Laminin, by Thermo Fisher Scientific (1 mentions)
Horse serum, by Thermo Fisher Scientific (1 mentions)
Halotag tmr ligand, by Promega (1 mentions)
Glutamine, by Thermo Fisher Scientific (1 mentions)
Bicuculline methiodide bic, by Bio-Techne (1 mentions)
Anti halotag, by Promega (1 mentions)
Albumin from bovine serum, by Merck Group (1 mentions)
Salubrinal, by Merck Group (1 mentions)
Indoxyl sulfate, by Merck Group (1 mentions)
Atrogin 1 ab168372, by Abcam (1 mentions)
β actin gtx109639, by GeneTex (1 mentions)
Bip 610978, by BD (1 mentions)
2 protocols using lipofectamine r 2000 reagent
1
Immunocytochemical Labeling of tPA Expressing Neurons
2
Indoxyl Sulfate-Induced Muscle Atrophy
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Indoxyl sulfate (IS), N‐Acetyl‐l‐cysteine (NAC), 2′,7′‐dichlorofluorescin diacetate (DCF‐DA), and salubrinal were purchased from Sigma‐Aldrich. The following antibodies were used: Phospho‐eIF2α (Ser51) (9721S) and Phospho AKT (Ser473) (9271S) from Cell Signalling Technology (Danvers, MA); eIF2α (D‐3) and MYH (H‐300) from Santa Cruz Biotechnology (Dallas, TX); BiP (610978) from BD Biosciences; myoG (GTX63352), GAPDH (GTX100118), and β‐actin (GTX109639) from Genetex (Hsinchu City, Taiwan). Atrogin 1 (ab168372) from Abcam (Cambridge, MA); myoD (5.8A) (NB100‐56511) from Novus Biologicals (Littleton CO), and Myc (CSB‐MA000041M0m) from Cusabio (China). AKT1 (C20) was kindly provided by Dr. Jim‐Tong Horng of Chang Gung University, Taiwan. Anti‐mouse IgG (H + L) and anti‐rabbit IgG (H + L) antibodies were purchased from Genetex. siRNA against XBP1 (siXBP1:CCUUGUAGUUGAGAACCAGGAGUUA) and scrambled siRNA (siCtrl: medium GC of Stealth negative control duplex) were purchased from ThermoFisher Scientific and transfected into cells with Lipofectamine(R) 2000 reagent (ThermoFisher Scientific), according to the manufacturer's protocol. The Smart Quant Green master mix for real‐time quantitative PCR assay was purchased from Protech (Taipei, Taiwan).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!