The largest database of trusted experimental protocols

Pires egfp plasmid

Manufactured by Takara Bio
Sourced in United States

The PIRES-eGFP-plasmid is a laboratory expression vector that contains the enhanced green fluorescent protein (eGFP) gene. This plasmid can be used for the expression and detection of target proteins in mammalian cell lines.

Automatically generated - may contain errors

2 protocols using pires egfp plasmid

1

Constructing DD-tagged Kir2.1 Plasmids

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cloning and mutagenesis was performed by standard techniques. Coding sequences of the human Kir2.1 (ImaGenes, Berlin, Germany) and the DD-ZsGreen1-Tag (Clontech Laboratories, Saint-Germain-en-Laye, France) were subcloned in a first step in a pcDNA3.1-plasmid (Invitrogen) to get the DD-ZsGreen1-Kir2.1 in pcDNA3.1-plasmid. We used as primers pDDfor_glu (GCGATCGGAT-CCGCCGCCACCATGGGAGTGCAGGTGG-AAACCATC), pDDrev_glu (CCCAGAGAATT-CGGGCAAGGCGGAGCCGGA), hukirfor_glu (GCGATCGAATTCGGCAG-TGTGCGAACCAAC), hukirrev_glu (CCCAGACTCGAGTCATATCTCCGACTCT-CGCCGTAA). For in vitro electrophysiological experiments we constructed a second in vitro vector carrying just DD-Kir2.1 within a pIRES-eGFP-plasmid (Clontech Laboratories). Therefore, in a first step, we cut out the ZsGreen1 from the DD-ZsGreen1-Kir2.1 in pcDNA3.1-vector by using DD-rev (CCCAGAGAATTCTTCCGGTTTTAGAAGCTC). Second, we subcloned DD-Kir2.1 in the pIRES-GFP-plasmid by using DDkircutfor (GCGATCGCTAGCGCCGCCACCATGGGAGTGCAGGTGGAAACCATC) and DDkircutrev (CCCAGAGTCGACTCATATCTCCGACTCTCGCCGTAA).
+ Open protocol
+ Expand
2

Generating Soluble FLAG-OLLAS-Flt3L Cell Line

Check if the same lab product or an alternative is used in the 5 most similar protocols
The cDNA of mouse Flt3L was cloned by RT-PCR of total splenic RNA from C57BL/6 mice, and was used to generate a construct encoding soluble FLAG and OLLAS tagged Flt3L, internal ribosomal entry site (IRES), and enhanced green fluorescence protein (EGFP), i.e., SFO.Flt3L-IRES-EGFP. The GenBank accession number for the sequence including the extracellular domain of mouse Flt3L is GU168042, and the IRES-EGFP sequence is from pIRES-EGFP plasmid (Clontech, Mountain View, CA, USA). CHO cells were then transfected using Lipofectamine 2000 (Life Technologies), with a mammalian expression vector plasmid encoding SFO.Flt3L-IRES-EGFP under CMV promoter and a neomycin resistance gene, constructed with the backbone of pEGFP-N1 (Clontech). CHO/Flt3L cells stably expressing the SFO.Flt3L-IRES-EGFP were produced by the following steps: (i) treatment of transfected CHO cells with G418 (1.5 mg/ml) for 1 week; (ii) enrichment of EGFP-positive CHO cells with FACSAria II cell sorter (BD Biosciences, San Diego, CA, USA); (iii) generation of clonal cells by limiting dilutions of FACS-sorted EGFP-high CHO/Flt3L cells; and (iv) selection of CHO/Flt3L clones after evaluating both levels of EGFP expression by FACS analysis and Flt3L secretion by anti-OLLAS Western blot analysis (22 (link)). Chosen CHO/Flt3L cells were cultured in cell culture flasks with DMC7 to produce CHO/Flt3L-conditioned medium.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!