The inflammatory response of macrophages was induced by 2MOI of V. vulnificus for 2 h and 4 h. Total RNA was extracted with TRIzol (Omega Bio-Tek). The reverse transcription was performed with PrimeScript Reverse Transcriptase (RR037A, Takara Bio) according to the manufacturer’s instructions. Real-time qPCR was performed as previously described (Xie et al., 2012 (link)). The primers were shown in Supplementary Table 1
Trizol
Manufactured by Omega Bio-Tek
Sourced in China, United States
TRIzol is a mono-phasic solution of phenol and guanidine isothiocyanate used for the isolation of total RNA from cells and tissues. It is a versatile reagent that can be used for the extraction of RNA, DNA, and proteins from the same sample.
Automatically generated - may contain errors
Lab products found in correlation
High capacity rna to cdna kit, by Thermo Fisher Scientific (2 mentions)
Primescript reverse transcriptase, by Takara Bio (1 mentions)
Sybr green, by Tiangen Biotech (1 mentions)
Realmastermix, by Tiangen Biotech (1 mentions)
First strand cdna synthesis kit, by Thermo Fisher Scientific (1 mentions)
Nucleic acid stain 1, by Roche (1 mentions)
Rtaq dna polymerase, by Takara Bio (1 mentions)
Genetools analysis software, by Syngene (1 mentions)
M mlv reverse transcriptase, by Promega (1 mentions)
Lightcycler 96 instrument, by Roche (1 mentions)
Ab93806, by Abcam (1 mentions)
Ab20737, by Abcam (1 mentions)
Ab181602, by Abcam (1 mentions)
Quantstudio 3 thermocycler, by Thermo Fisher Scientific (1 mentions)
Itaq universal sybr green supermix, by Bio-Rad (1 mentions)
E z n a total rna kit 1, by Omega Bio-Tek (1 mentions)
Isoflurane, by Merck Group (1 mentions)
Goat anti rabbit igg h l fitc, by Abcam (1 mentions)
Rt qpcr kit, by Takara Bio (1 mentions)
Atp determination kit, by Promega (1 mentions)
6 protocols using trizol
1
Macrophage Inflammatory Response to V. vulnificus
2
Quantitative Analysis of Plectin mRNA Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the podocytes using TRIzol (Omega Bio‐Tek: Norcross, GA), and cDNA was synthesized using a First‐strand cDNA Synthesis Kit (Fermentas, Burlington, Ontario, Canada). Real‐time quantitative PCR (qPCR) was performed in a 20 μL reaction mixture prepared with RealMaster Mix and SYBR Green (Tiangen, Beijing, China). The qPCR programme comprised the following steps: 95°C for 1 minutes followed by 35 cycles of 95°C for 5 seconds, 58°C for 15 seconds, and 68°C for 20 seconds. Each sample was analysed in triplicate, and GAPDH was used as an endogenous control. The following plectin primers were used in the study: forward: 5′‐GCACAAGCCCATGCTCATAGA‐3′ and reverse: 5′‐CAGGAGCCGTGTAACTCCC‐3′; amplicon size: 112 bp. The following GAPDH primers were used in the study: forward: 5′‐GACAACTTTGGCATCGTGGA‐3′ and reverse: 5′‐ATGCAGGGATGATGTTCTGG‐3′; amplicon size 135 bp.
3
Gene Expression Analysis by RT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cells at indicated time points using Trizol (Omega Bio-tek, Shenzhen, China), according to the manufacturer’s instructions, and then reverse transcribed into cDNA with M-MLV Reverse Transcriptase (Promega, Fitchburg, WI, USA). The cDNA was analyzed by RT-PCR using rTaq DNA polymerase (Takara, Tokyo, Japan). Amplicons from the RT-PCR reactions were separated on a 1.5% agarose gel, which was stained with nucleic acid stain I (Roche Diagnostics, Mannheim, Germany), photographed, and analyzed using the Gene Tools Analysis Software (Syngene, Cambridge, UK). The cDNA was performed by qRT-PCR using a LightCycler 96 instrument (Roche). The qRT-PCR data were presented as normalized ratios, which were calculated using ΔΔCT method by LightCycler system and software (Roche, Basel, Switzerland). The human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal standard. The primer sequences are listed in Table 1 .
4
High-fat diet alters cholesterol metabolism
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
High-fat diet (HFD; 45% fat, 35.6% carbohydrate, 19.4% protein) and normal diet (ND; 10% fat, 75.9% carbohydrate, 14.1% protein) were obtained from Nantong Trophy Feed Technology (Nantong, China). The neon lights were bought from Hengyida Lighting (Changzhou, China). Kits for the detection of total cholesterol (TC), triglyceride (TG) and low density lipoprotein cholesterol (LDL-C) were acquired from Meikang Biotechnology (Ningbo, China). The ELISA kit for apolipoprotein B (ApoB) was from DEVELOP (Wuxi, China). TRIzol was purchased from Omega Bio-Tek (Guangzhou, China). The kit for reverse transcription and UltraSYBR Mixture were purchased from CWBIO (Beijing, China). The BCA kit for protein quantification and 5X SDS-PAGE loading buffer were obtained from Beyotime Biotechnology (Shanghai, China). The antibody against CLOCK was purchased from Signalway Antibody (SAB, USA). Antibodies against APOB (1:1000, ab20737), BMAL1 (1:5000, ab93806) and GAPDH (1:5000, ab181602) were bought from Abcam (MA, USA). Ready-for-use hematoxylin-eosin and those agents for western blot were bought from Solarbio (Shanghai, China).
5
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To measure gene expression (mRNA), comparative RT‐PCR (500 μg) was performed as previously described (Villalvilla et al., 2014 (link)) using iTaq Universal SYBR Green Supermix (Bio‐Rad, USA) and KiCqStart SYBR Green primers (Merk Sigma‐Aldrich, Germany) in a QuantStudio3 thermocycler (Thermo Fisher, USA). TRIzol and EZNA Total RNA Kit I (Omega Bio‐Tek, USA) were used to isolate RNA, and High‐Capacity RNA‐To‐cDNA Kit (Thermo Fisher, USA) was used to retrotranscribe 500 μg of RNA.
6
Chondrocyte Differentiation Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
d -Glucosamine HCl (purity > 98.5 %, MB1695) was purchased from Dalian Meilun Biotechnology™ (Dalian, China). Dexamethasone (No. D1756) and isoflurane were acquired from Sigma-Aldrich (St. Louis, MO, USA) and Baxter Healthcare™ (Deerfield, IL, USA), respectively. Primary antibody dilution buffer (NO. G2025) was procured through Servicebio ™ (Wuhan, China). Trizol® was procured through Omega Bio-Tek™ (Doraville, GA, USA). The SYBR Green dye and reverse transcription and real-time quantitative polymerase chain reaction (RT-qPCR) kits were procured through TaKaRa Biotechnology™ (Dalian, China). Phospho-SMAD Family Member 2 (p-Smad2) (AP0548) and ACAN (A8536) were procured through Abclonal™ (Wuhan, China); TGFβR1 (ab31013), COL2A1 (ab34712), Smad2 (ab40855), SOX9 (ab185230) antibodies and goat anti-rabbit IgG H&L (FITC) (ab6717) were procured through ABCAM™ (Shanghai, China). Oligonucleotide primers were procured through TIANYIHUIYUAN™ (Guangzhou, China). DMEM/F-12 medium and fetal bovine serums (FBS) were procured through Gibco™ (Carlsbad, California, USA). SB431542 was procured through Merck ™ (Beijing, China). MTS Assay Kit® and ATP Determination Kit® (S0026) were procured through Promega™ (Fitchburg, Wisconsin, USA) and Beyotime™ (Wuhan, China), separately. The remaining materials consisted of analytical-grade reagents/chemicals.
+ Expand
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!