Edta anticoagulant vacutainer tubes

Blood for full blood counts, CD4+ T cell count measurement and viral load quantification was collected in EDTA anticoagulant vacutainer tubes [Becton Dickinson (BD), Franklin Lakes, New Jersey, USA]. ANCs were enumerated by full blood count using the automated XN 1000 Hematology Analyzer (Sysmex, Kobe, Hyogo, Japan). CD4 counts were measured using BD Trucount and analyzed on a four-parameter FACS Calibur flow cytometer (BD). Viral loads were determined using the NucliSENS EasyQ HIV-1 v2.0 kit with a detection limit of 20 copies/ml (BioMérieux, Marcy-l'Étoile, France).

Blood samples were collected with ethylenediamine tetra-acetic acid (EDTA) anticoagulant vacutainer tubes (BD Franklin Lakes NJ, USA). Genomic DNA was extracted from lymphocytes using the QIAamp DNA Blood Mini Kit (Qiagen, Berlin, Germany) and DNA samples were frozen at −80°C. Genotyping of CTLA-4 -1722T/C polymorphism was carried out using the polymerase chain reaction-ligase detection reactions (PCR-LDR) method [12] (link). The Shanghai Biowing Applied Biotechnology Company provides technical support for genotyping. One hundred and sixty samples were randomly selected and reciprocally tested with directly sequencing for quality control, and the reproducibility were 100%. The primers of directly sequencing used for CTLA-4 -1722T/C genotyping were as follows: F: 5' GCAATAACAACCTAATGGGCAC 3'; R: 5' ACTTCCACAGGCTGAACCACT 3' (Figure S1).