For ATPase activation, ΦX174 RFI, RFII or Virion DNA (New England BioLabs®) was used. Linear plasmid DNA was produced by treating ΦX174 RFI with PsiI (New England BioLabs®) followed by heat inactivation.
All oligonucleotides were purchased from Metabion (Planegg, Germany) and purified via polyacrylamid gels. RB22 (CGGGTAGTAGATGAGCGCAGGGACACCGAGGTCAAGTACATTACCCTCTCATAGGAGGTG) and RB27 (CACCTCCTATGAGAGGGTAATGTACTTGACCTCGGTGTCCCTGCGCTCATCTACTACCCG) were annealed in annealing buffer (50 mM NaCl, 25 mM Tris pH 7.5, 10 mM MgCl2) with a molar excess of 1.1 of unlabeled oligo over the labeled oligo. Oligonucleotides for ATPase and DNA binding assays had a different sequence and were annealed in a 1:1 molar ratio. HS 21 (CGCTTTATCAGAAGCCAGACATTAACGCTTCTGGAGAAACTCAACGAGCTGGACGCGGAT) was annealed to the complement HS37 (ATCCGCGTCCAGCTCGTTGAGTTTCTCCAGAAGCGTTAATGTCTGGCTTCTGATAAAGCG). If shorter double-stranded DNA was used, the HS21 sequence was trimmed on the 3′ end and annealed to the oligonucleotide with the respective complement sequence. For the fluoresecence anisotropy binding experiments, the dsDNA was 6-FAM labeled on the 5′ terminus.
All oligonucleotides were purchased from Metabion (Planegg, Germany) and purified via polyacrylamid gels. RB22 (CGGGTAGTAGATGAGCGCAGGGACACCGAGGTCAAGTACATTACCCTCTCATAGGAGGTG) and RB27 (CACCTCCTATGAGAGGGTAATGTACTTGACCTCGGTGTCCCTGCGCTCATCTACTACCCG) were annealed in annealing buffer (50 mM NaCl, 25 mM Tris pH 7.5, 10 mM MgCl2) with a molar excess of 1.1 of unlabeled oligo over the labeled oligo. Oligonucleotides for ATPase and DNA binding assays had a different sequence and were annealed in a 1:1 molar ratio. HS 21 (CGCTTTATCAGAAGCCAGACATTAACGCTTCTGGAGAAACTCAACGAGCTGGACGCGGAT) was annealed to the complement HS37 (ATCCGCGTCCAGCTCGTTGAGTTTCTCCAGAAGCGTTAATGTCTGGCTTCTGATAAAGCG). If shorter double-stranded DNA was used, the HS21 sequence was trimmed on the 3′ end and annealed to the oligonucleotide with the respective complement sequence. For the fluoresecence anisotropy binding experiments, the dsDNA was 6-FAM labeled on the 5′ terminus.