PCR reaction was carried out in a 25 µl reaction volume containing 1 μg/µl of genomic DNA, 2.5 µl of 10X Taq polymerase buffer with 1.5 mM MgCl2, 200 μM of each dNTPs (Q-Biogene, USA), 15 µg of each primer and 1 unit of Taq DNA polymerase (Q-Biogene, USA). The primer sequences were used for exon 4 of p53 gene as upstream 5’ (GATGCTGTCCGCGGACGATATT) 3’ and downstream 5’(CGTGCAAGTCACAGACTTGGC) 3’. A negative control, without template DNA was included in each round of reactions. DNA amplification was performed in a Techne thermocycler, USA. PCR thermal was performed in 35 cycles. Each cycle consisted of 94°C denaturizing for 45 s, 57°C annealing for 45 s, and 72°C extension for 1-min. The thermal cycles were started with an initial denaturizing of 96°C for 5 min and a final 72°C extension for 10 min for polishing the ends (making smooth) of PCR products.
Taq dna polymerase
Manufactured by Qbiogene
Sourced in France
Taq DNA polymerase is a thermostable enzyme derived from the bacterium Thermus aquaticus. It is a widely used enzyme in molecular biology for DNA amplification via the polymerase chain reaction (PCR) technique. The core function of Taq DNA polymerase is to catalyze the synthesis of new DNA strands complementary to a given DNA template, enabling the exponential amplification of specific DNA sequences.
Automatically generated - may contain errors
5 protocols using taq dna polymerase
1
Amplification of p53 Gene Exon 4
2
Microbial Diversity Analysis via PCR-DGGE
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Extraction, PCR and denaturing gradient gel electrophoresis were undertaken as described in Sweet & Bythell (2012 ). DNA was extracted from all samples using QIAGEN DNeasy Blood and Tissue kits, and bacterial 16S rRNA gene diversity was amplified using primers 357F and 518R (Sanchez et al. 2007 ). PCR protocols were as in Sweet & Bythell (2012 ). Ciliate 18S rRNA was amplified using primers CilF and CilDGGE‐r (Janse et al. 2004 ). PCR protocols were as in Sweet & Bythell (2012 ). For each of the above primer pairs, 30 μL PCR mixtures containing 1.5 mm MgCl2, 0.2 mm dNTP (promega), 0.5 mm of each primer, 2.5 Ul of Taq DNA polymerase (QBiogene), incubation buffer and 20 ng of template DNA were used as in Sweet & Bythell (2012 ). DGGE was performed as in Sweet & Bythell (2012 ) using the D‐Code universal mutation detection system (Bio‐Rad). PCR products were resolved on 10% (w/v) polyacrylamide gels for bacterial 16S rRNA gene diversity and 8% (w/v) for ciliate diversity. Bands of interest (those which explained the greatest differences/similarities between samples) were excised from DGGE gels, re‐amplified with the same original primers, labelled using Big Dye (Applied Biosystems) transformation sequence kit and sent to Genevision (Newcastle University, UK) for sequencing.
3
Microbial Diversity Assessment through DNA Extraction, PCR, and DGGE
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Extraction, PCR and denaturing gradient gel electrophoresis were undertaken as described in [16 (link)]. DNA was extracted from all samples using QIAGEN DNeasy blood and tissue kits, and bacterial 16S rRNA gene diversity was amplified using primers 357F and 518R. PCR protocol was as in [17 (link)]. Ciliate 18S rRNA gene diversity was amplified using primers CilF and CilDGGE-r. PCR protocol was as in [17 (link)]. For each of the above primer pairs, 30 µl PCR mixtures containing 1.5 mM MgCl2, 0.2 mM dNTP (Promega), 0.5 mM of each primer, 2.5 Ul of Taq DNA polymerase (QBiogene), incubation buffer and 20 ng of template DNA [17 (link)]. DGGE was performed as in [17 (link)] using the D-Code universal mutation detection system (Bio-Rad). PCR products were resolved on 10% (w/v) polyacrylamide gels for bacterial 16S rRNA gene diversity and 8% (w/v) for ciliate diversity. Bands of interest (those which explained the greatest differences/similarities between samples) were excised from DGGE gels, re-amplified with the same original primers, labelled using a big dye (Applied Biosystems) transformation sequence kit and sent to Genevision (Newcastle University, UK) for sequencing.
4
Microsatellite Marker Identification Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For identifying the microsatellite markers, seven pairs of primers described by Kijas et al. (1997) (link) were tested. The characteristics of these primers, namely, TAA15, TAA27, TAA41, CAC23, CAC15, CAC33, and CAC39 are given in Table 2. Polymerase chain reactions (PCRs) were performed in a 25-µL reaction mixture containing 20-30 ng DNA (approximately 1 µL), 2 pM each primer, 20 mM dNTPs, 1.25 U Taq DNA polymerase (QBIO gene, France), 2.5 µL enzyme buffer (10X), 3 mM MgCl 2 , and 25 µL MilliQ water, QSF. The amplifications were performed in a thermocycler (TC-512 Techne resistance, Burlington, NJ, USA) programmed to execute the following steps: initial denaturation for 4 min at 94°C followed by 32 cycles of denaturation for 1 min at 94°C, annealing (specific for each primer) at 55°-60°C for 30 s, and extension at 72°C for 1 min and one cycle at 72°C for 4 min. To increase the resolution of bands in electrophoresis and to accomplish a better separation of alleles, the migration patterns of PCR products were observed on a 10% polyacrylamide gel.
5
SRAP Primer Optimization and Gel Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Seven SRAP primer-pair combinations were selected from three forward and four reverse primers (Table 2) (Vandemark et al., 2006; (link)Saha et al., 2010) (link). These primer pairs were designated F8-R9, F8-R15, F9-R8, F9-R9, F13-R7, F13-R9, and F13-R15.
Amplifications were performed using a thermal gradient cycler TProfessional TRIO Thermocycler (Biometra, Germany) in a total volume of 25 µL containing 30 ng genomic DNA, 10X PCR buffer, 0.25 mM each primer (reverse and forward), 3 mM MgCl 2 , 1 mM dNTPs, 1.5 unit Taq DNA Polymerase (Qbiogene, France), and double-distilled water. The thermal cycling profile for all reactions consisted of a single cycle of 95°C for 5 min followed by 5 cycles of 94°C for 1 min, 40°C for 1 min, 72°C for 1 min, 35 cycles of 94°C for 1 min, 47°C for 1 min, 72°C for 1 min, and a final extension at 72°C for 10 min. PCR products were resolved on 2% agarose gel stained with 0.5 pg/mL ethidium bromide and were electrophoresed in 0.5X TBE buffer (pH 8.0) run at 100 V for 2 h.
The bands were visualized under UV light by means of a Gel-Doc 2000 image analysis system (Bio-Rad, USA). Amplified bands were scored for the presence (1) or absence (0) of bands of the same size for each primer combination to generate the 0/1-matrix.
The core sequences 'CCGG' in the forward primers and 'AATT' in the reverse primers are in bold.
Amplifications were performed using a thermal gradient cycler TProfessional TRIO Thermocycler (Biometra, Germany) in a total volume of 25 µL containing 30 ng genomic DNA, 10X PCR buffer, 0.25 mM each primer (reverse and forward), 3 mM MgCl 2 , 1 mM dNTPs, 1.5 unit Taq DNA Polymerase (Qbiogene, France), and double-distilled water. The thermal cycling profile for all reactions consisted of a single cycle of 95°C for 5 min followed by 5 cycles of 94°C for 1 min, 40°C for 1 min, 72°C for 1 min, 35 cycles of 94°C for 1 min, 47°C for 1 min, 72°C for 1 min, and a final extension at 72°C for 10 min. PCR products were resolved on 2% agarose gel stained with 0.5 pg/mL ethidium bromide and were electrophoresed in 0.5X TBE buffer (pH 8.0) run at 100 V for 2 h.
The bands were visualized under UV light by means of a Gel-Doc 2000 image analysis system (Bio-Rad, USA). Amplified bands were scored for the presence (1) or absence (0) of bands of the same size for each primer combination to generate the 0/1-matrix.
The core sequences 'CCGG' in the forward primers and 'AATT' in the reverse primers are in bold.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!