Log In Sign up
The largest database of trusted experimental protocols

Pegfp plasmid

Manufactured by BD
Visit Supplier

The PEGFP plasmid is a laboratory tool used for gene expression studies. It contains the enhanced green fluorescent protein (EGFP) gene, which can be used to track and visualize the expression of proteins in cells.

Automatically generated - may contain errors

Lab products found in correlation

Histrap ff column, by GE Healthcare (1 mentions) Glass bottom dishes, by World Precision Instruments (1 mentions) Lipofectamine reagent, by Thermo Fisher Scientific (1 mentions)

Spelling variants of this product

PEGFP-N1 plasmid (3 citations) PEGFP-C3 plasmid (2 citations)

2 protocols using pegfp plasmid

1

Recombinant Expression of CjCel9A CBM

Check if the same lab product or an alternative is used in the 5 most similar protocols
The carbohydrate binding module (CBM) sequence of Cjcel9A (GenBank: AB264777.1) was amplified using primers 5′‐GAGGGATCCC(CAC)×6GCACCAGTAACTATC‐3′ and 5′‐GAGGGTACCCCTGGACCTACAGACCT‐3′ (the underlined sequence is complementary to the Cjcel9A CBM), inserted into pEGFP plasmid (BD Biosciences Clontech) and transformed into the XL‐blue strain of E. coli for expression. The recombinant protein was purified using a His‐trap™ FF column (GE Healthcare) following the manufacturer's protocol.
Liu W., Tanimura A., Nagara Y., Watanabe T., Maegawa S, & Toyohara H. (2019). Wetland environmental bioreactor system contributes to the decomposition of cellulose. Ecology and Evolution, 9(14), 8013-8024.
+ Open protocol
+ Expand
2

Fluorescent Labeling of Transfected Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
pEGFP plasmid (BD Biosciences) was transfected into NIH 3T3 fibroblasts using lipofectamine reagent (Invitrogen, Carlsbad, CA) based on a standard protocol. After transfection, the cells were cultivated onto the glass bottom dishes (World Precision Instrument, Sarasota, FL) by the single-cell density. After 24 h, the cells were fluorescently labeled with GFP. Ten minutes before image acquisition, 20-µg/ml Hoechst 33,342 was applied to the cell culture to label the nuclei48 .
Lan T., Yu M., Chen W., Yin J., Chang H.T., Tang S., Zhao Y., Svoronos S., Wong S.W, & Tseng Y. (2021). Decomposition of cell activities revealing the role of the cell cycle in driving biofunctional heterogeneity. Scientific Reports, 11, 23431.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!