Total RNAs of cells were extracted using TRIzol reagent according to the manufacturer’s manual. Briefly, TRIzol was added to the cell lysate, and then chloroform and phenol-chloroform were added to precipitate RNA. The RNA pellets were washed using ethanol, solubilized in diethyl pyrocarbonate (DEPC)-treated water, and then reverse transcribed using murine leukemia virus (MLV) reverse transcriptase (Promega) and oligo(dT) primers (Promega). Quantitative PCR on DPP4 RNA was performed using DPP4-specific primers and a SYBR qPCR kit (Bio-Rad) in a CFX qPCR instrument (Bio-Rad). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) RNA was used as a control. The primers are as follows: for DPP4, forward, 5′-AGTGGCGTGTTCAAGTGTGG-3′, and reverse, 5′-CAAGGTTGTCTTCTGGAGTTGG-3′; for GAPDH, forward, 5′-GGAAGGTGAAGGTCGGAGTCAACGG-3′, and reverse, 5′-CTCGCTCCTGGAAGATGGTGATGGG-3′.
Sybr qpcr kit
Manufactured by Bio-Rad
Sourced in United States
The SYBR qPCR kit is a reagent designed for quantitative real-time PCR (qPCR) analysis. It contains a SYBR Green-based fluorescent dye that binds to double-stranded DNA, allowing for the detection and quantification of target DNA sequences during the PCR amplification process.
Automatically generated - may contain errors
3 protocols using sybr qpcr kit
1
Quantifying DPP4 Expression in Cells
2
Quantifying TLR4 and NF-kB Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
According to the instructions, TRIzol reagent was used to extract the total DNA from the brain, and then the kit was used for reverse transcription. Real-time fluorescence quantitative PCR was performed on a BioRad IQ5 real-time fluorescence PCR instrument using the SYBR qPCR kit. The list of primers is presented in Table 2 .
Primer sequences list
| Gene_name | Primer sequence | Product length |
|---|---|---|
| TLR4 | Sense: GTGGCTTTATTTTGCCTTGT | 171 |
| antisense: TTTTGCACCCTCCTTCTTT | ||
| NF-κB | Sense: GGGGTATGCACCGTAACA | 195 |
| antisense: GTCTCCTCCGCCTTCTG |
3
Total RNA Extraction and Real-Time PCR Analysis
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!