Platinum sybr green qpcr supermix udg system

Total RNA was isolated from samples using Trizol (Invitrogen, USA). The yield and quality of RNA samples were determined using the NanoDrop 2000 Spectrophotometer (Thermo Scientific, USA). For microRNA analysis, total RNA was reverse transcribed into cDNA using a specific stem-loop real-time PCR miRNA kit (Ribobio, Guangzhou, China). qRT-PCR was performed using the Platinum SYBR Green qPCR SuperMix-UDG system (Invitrogen, USA) on an Applied Biosystems 7900 Real-Time PCR system. 5S rRNA was used as an internal control and all samples were normalized to internal controls. Quantification of the fold change in gene expression was determined by the relative quantification method. Primers of miR-124 and 5S rRNA used in this study are listed as follows:
miR-124 stem-loop RT: 5’-GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACGGCATTC -3’;
miR-124 forward: 5’-GGTAAGGCACGCGGT-3’;
miR-124 reverse: 5’-CAGTGCGTGTCGTGGAGT-3’;
5S rRNA stem-loop RT: 5’-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCAGGCG-3’;
5S rRNA forward: 5’-CTGGTTAGTACTTGGACGGGAGAC-3’;
5S rRNA reverse: 5’-GTGCAGGGTCCGAGGT-3’
Flotillin-2 forward: 5’- GGAGGCTGTTGTGGTTCTGA-3’
Flotillin-2 reverse: 5’- GTCTCTACGTCCTCACAGCG-3’
β-actin forward: 5’- CCGTAAAGACCTCTATGCC-3’
β-actin reverse: 5’- CTCAGTAACAGTCCGCCTA-3’

DNase I-digested total RNA of each condition was transcribed into cDNA using the Superscript III first strand kit (Invitrogen, Karlsruhe, Germany). 18S rRNA served as an internal standard. For quantitative real-time PCR, the Platinum SYBR Green qPCR SuperMix-UDG system (Invitrogen, Karlsruhe, Germany) was used in the ABI Prism 7000 Sequence DetectionSystem (Applied Biosystems, Foster City, USA). Each PCR amplification step was carried out using the following 5 conditions: 2 minutes at 95°C, followed by a total of 40 temperature cycles (15 seconds at 95°C, 15 seconds at 57°C, and 1 minute at 72°C). Specificity of the reactions was confirmed by performing a dissociation protocol after each cycle and comparison of the results with the expected melting-point temperature of the amplicon as well as by verification of the expected size of the product on a 2% agarose gel. The relative expression levels of these genes were calculated by the ddCT method with normalization to 18S expression. Primers used for quantitative RT-PCR are listed in Supplementary Table 1 (available online at http://dx.doi.org/10.1155/2014/131950).

Further, 1 × 10⁵ MG63 cells were seeded in scaffolds, and the qRT-PCR test was used to assess the expression of specific osteogenic genes, COL-1, TGF-Β1, ITG-β1, M-CSF, OSN, BGLAP, OSP, PGE₂, RUNX2, and housekeeping gene β-actin (Table 1). After 7 days in culture, the total RNA was extracted using Trizol (Ambion^®, Life Technologies Corporation, Van Allen Way, Carlsbad, CA, USA) according to the manufacturer’s instructions. Further, cDNA was synthesized by reverse transcription reactions following the manufacturer’s instructions of the commercial SuperScript III kit, First-Strand Synthesis Supermix (Invitrogen Life Technologies Corporation-Van Allen Way, Carlsbad, CA, USA), and cDNA was used for qRT-PCR with the Step One Plus Time PCR thermocycler detection system (Thermofisher Scientfic Inc., Waltham, MA, USA) using the Platinum SYBR Green qPCR SuperMix-UDG system (Invitrogen Life Technologies Corporation-Van Allen Way, Carlsbad, CA, USA) and specific primers according to the manufacturer’s instructions. The relative quantification was calculated for each gene by the comparative method of ΔΔCt [25 (link)].