Taqman snp genotyping assay

Genomic DNA was extracted from blood leukocytes by optimized salting out procedure (Salazar et al., 1998 (link)). Genotyping of LPL rs283, PLIN1 rs2304795, PLIN1 rs1052700 (14995A>T), and ADRB3 rs4994 polymorphisms were performed by real-time polymerase chain reaction (qPCR), using TaqMan^® SNP Genotyping Assays (Life Technologies, CA, United States). PCR assays contained 12.5 μl of TaqMan^® Genotyping Master Mix (2X; Life Technologies CA, United States), 1.25 μl of TaqMan^® SNP Genotyping Assay (20X; catalog numbers: 4351379, 4351379, 4351379, and 4351379), and 2 μl of DNA (25 ng) diluted in nuclease-free water. The thermal cycling protocol was initiated with a cycle for 10 min at 95°C and followed by 40 cycles at 95°C for 15 s and 60°C for 1 min using standard conditions for a real-time system (Life Technologies). Genotyping was performed using the allelic discrimination plot issued after PCR amplification in the StepOne software v. 2.2 (Life Technologies). No template controls were included per triplicate in each genotyping experiment plate. Genotyping was randomly repeated on 20% of the samples for quality control purposes without finding differences.

After several cycles of UV irradiation, examination of STR profiles from the dried blood samples became difficult, and we tried to perform SNP genotyping instead. We performed 12 TaqMan SNP Genotyping Assays (Thermo Scientific; Table 1) using the StepOnePlus Real-Time PCR System in a reaction volume of 10µL, which comprised 2× TaqPath ProAmp Master Mix (Applied Biosystems), 0.25 µL 40× TaqMan SNP Genotyping Assay (containing primers and probes), and 1.0 µL genomic DNA samples. The genotyping amplification protocol was 60 °C for 30 s and 95 °C for 5 min, followed by 45 cycles of 95 °C for 5 s and 60 °C for 30 s. To confirm the detection, multiple diluted standard DNAs (0.02 ng to 0.14 ng) were used to detect the SNP genotypes. As controls, each SNP was detected in all bloodstains before UV irradiation. Detailed information on the SNPs that were used in this study is deposited in dbSNP.Table 1

SNP loci for analysis of ultraviolet-irradiated dried blood samples.

No	SNP ID	Allele	Chromosome	MAF
1	rs1736442	C/T	Chr18	0.3569
2	rs1528460	C/T	Chr.15	0.2752
3	rs1382387	A/C	Chr.16	0.2946
4	rs560681	A/G	Chr.1	0.2926
5	rs733559	C/T	Chr.14	0.2897
6	rs3892905	A/G	Chr.3	0.2770
7	rs12913832	A/G	Chr.15	0.0830
8	rs1393350	A/G	Chr.11	0.0793
9	rs2192512	C/T	Chr.20	0.4530
10	rs7652776	C/G	Chr.3	0.4645
11	rs17497475	A/C	Chr.4	0.4792
12	rs9292196	C/T	Chr.5	0.1542

MAF minor allele frequency.

The identified variants were genotyped in the controls cohort by made-to-order TaqMan SNP Genotyping Assay (ThermoFisher, USA). Variants that are not readily-available were custom designed and genotyped using the TaqMan SNP Genotyping Assay (ThermoFisher, USA). Variants that were not readily available as pre-designed Made-to-order TaqMan® SNP Genotyping Assay and cannot be custom designed were then genotyped using Sanger sequencing method.

DNA from blood samples was isolated using QIAamp DNA Blood Mini Kit according to the manufacturer’s protocol (Qiagen, Hilden, Germany). DNA was eluted from the columns in a volume of 20 µL. To further purify and concentrate the isolated DNA for SNP genotyping, DNA was precipitated by ethanol precipitation. The DNA pellet was washed once and the resuspended in 20–100 µL H20. DNA concentration was determined using a nanophotometer NP60 (Implen, Munich, Germany).
SNP genotyping was performed using single-tube human TaqMan SNP Genotyping Assays (Thermofisher, Waltham, MS, USA). Each reaction mix contained 10 ng template DNA, 0.5µL specific TaqMan SNP Genotyping Assay and 5 µL of 2xTaqPath ProAmp™ Mastermix in a total reaction volume of 10 µL. The polymerase chain reaction (PCR) was performed in a QuantStudio™ 5 Real-Time PCR System (Thermofisher, Waltham, MS, USA) using the following PCR program: pre-read of 30 s at 60 °C, enzyme activation at 95 °C for 5 min, 40 cycles of denaturation (5 s, 95 °C) and annealing (30 s, 60 °C), followed by a last post-read of 30 s at 60 °C. Allelic calls were identified by Quant Studio Design and Analysis Software (Thermofisher, Waltham, MS, USA).

Polymorphism of IL 17 − 197 G > A (rs2275913) was genotyped using the [TaqMan SNP genotyping assay] (Cat. no. 4351379, Applied Biosystems, ABI, Foster City, CA, USA).
The TaqMan SNP genotyping assay contains sequence-specific forward and reverse primers to amplify the polymorphic sequence of interest and two TaqMan minor groove binder (MGB) probes with nonfluorescent quenchers (VIC-labeled probe to detect allele 1 sequence and FAM-labeled probe to detect allele 2 sequence). The context sequence [VIC/FAM]: TGCCCTTCCCATTTTCCTTCAGAAG[A/G] AGAGATTCTTCTATGACCTCATTGG.
According to manufacturers’ instructions, briefly, 1 ul of SNP assay was added to 10 ul of TaqMan Genotyping Master Mix (Applied Biosystems, ABI, Foster City, CA, USA, Cat. no: 4371353), genomic DNA, and the total reaction volume was completed to 20 ul. The PCR procedure included a pre-heating stage of the sample at 60°C for 30 s and 10 min at 95 °C, followed by 40 cycles of thermal cycling. Each cycle consisted of a denaturation step at 95°C for 15 s, followed by annealing and extension at 60°C for 1 min. The process ended with a post-read step at 60°C for 30 s.

DNA was extracted from buccal cells and purification of genomic DNA was performed with a standard commercial extraction kit (MagNA Pure LC DNA Isolation Kit I; Roche Diagnostics, Mannheim, Germany) in a MagNA Pure LC System (Roche, Mannheim, Germany). Genotyping of the rs3796863 polymorphism was conducted with a commercial TaqMan^® SNP Genotyping Assay (C___1216944_10, Applied Biosystems, Carlsbad, USA) on a Mastercycler^® ep realplex (Eppendorf, Hamburg, Germany) according to manufacturers’ standard protocol. Genotyping of SNP rs53576 was conducted using the commercial TaqMan^® SNP Genotyping Assay (C___3290335_10, Applied Biosystems, Carlsbad, USA) on a Mastercycler^® ep realplex (Eppendorf, Hamburg, Germany) according to manufacturers’ standard protocol.