RNA was extracted from tissues using TRIzol reagent (TaKaRa, Shiga, Japan). cDNA synthesis was performed using PrimeScript RT kit (RR047A, TaKaRa). Real-time quantitative PCR was performed using a standard SYBR Green PCR kit (Takara, RR820A). We used the 2−ΔΔCT method for calculations. The primers for the mRNA TNFAIP6 were 5′-TGCTACAACCCACACGCAAA-3' (forward) and 5′-CTCAGGTGAATACGCTGACCA-3' (reverse). The primers for the mRNA PSMB2 were 5′- ATCCTCGACCGATACTACACAC-3' (forward) and 5′-GAACACTGAAGGTTGGCAGAT -3" (reverse). The primers for mRNA IRF4 were 5′-GCGGTGCGCTTTGAACAAG-3' (forward) and 5′- ACACTTTGTACGGGTCTGAGA-3' (reverse). The primers for mRNA IFNAR2 were 5′-TCATGGTGTATATCAGCCTCGT-3' (forward) and 5′-AGTTGGTACAATGGAGTGGTTTT -3" (reverse). The primers for GAPDH, 5′-CCCATCACCATCTTCCAGGAG-3' (forward) and 5′-GTTGTCATGGATGACCTTGGC-3' (reverse).
Primescript rt kit
Manufactured by Takara Bio
Sourced in Japan, China, United States, Germany
The PrimeScript RT kit is a reagent system designed for the reverse transcription of RNA into cDNA. It contains the PrimeScript Reverse Transcriptase enzyme, along with an RNase inhibitor and other necessary components for the reverse transcription reaction.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (448 mentions)
Trizol, by Thermo Fisher Scientific (141 mentions)
Sybr premix ex taq, by Takara Bio (75 mentions)
Trizol reagent, by Takara Bio (70 mentions)
Sybr premix ex taq 2, by Takara Bio (60 mentions)
Rnaiso plus, by Takara Bio (50 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (47 mentions)
Sybr premix ex taq 2 kit, by Takara Bio (42 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (41 mentions)
Abi 7500 real time pcr system, by Thermo Fisher Scientific (38 mentions)
Tb green premix ex taq 2, by Takara Bio (32 mentions)
Gdna eraser, by Takara Bio (31 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (31 mentions)
Sybr premix ex taq kit, by Takara Bio (25 mentions)
Sybr premix ex taqtm 2 kit, by Takara Bio (24 mentions)
Sybr green pcr master mix, by Takara Bio (24 mentions)
Trizol kit, by Thermo Fisher Scientific (24 mentions)
Trizol, by Takara Bio (22 mentions)
Abi 7500 system, by Thermo Fisher Scientific (19 mentions)
Sybr green, by Takara Bio (18 mentions)
1 218 protocols using primescript rt kit
1
RNA Extraction and qPCR Analysis
2
Quantifying HOXB3 and miR-375 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was extracted from TRIzol, and the reverse transcription of a part of RNA was carried out using PrimeScript™ RT kit (Takara, Dalian, China). The complementary DNA (cDNA) after reverse transcription was used for subsequent expression detection of HOXB3 and glyceraldehyde phosphate dehydrogenase (GAPDH). Another part of RNA was taken, and reverse transcription was performed using the miRNA reverse transcription kit (Shanghai Haifang Biotechnology Co., Ltd., Shanghai, China). The cDNA after reverse transcription was adopted for subsequent expression detection of miR-375 and U6. RT-qPCR was performed with SYBR Premix Ex Taq II Kit (Takara). The primer information is listed in Table 2 . GAPDH and U6 were selected as control genes of HOXB3 and miR-375, respectively. The 2-∆∆Ct quantification method was used for data analysis.
3
Comprehensive RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from tissues or cells using TRIzol reagent (Takara, Dalian, China). Cytoplasmic and nuclear RNA were isolated from cells using cytoplasmic and nuclear RNA extraction kits (Norgen Biotek, Thorold, ON, Canada) per the manufacturer’s instructions. RNase R therapy was performed according to a previously described protocol.10 (link) In summary, approximately 2 μg total RNA was treated with or without 3 μg RNase R (Epicenter Technologies, Madison, WI, USA) at 37°C for 30 min. RNA was reverse transcribed into cDNA using the PrimeScript RT Kit (Takara) according to the manufacturer’s instructions. The sequences of primers for quantitative real-time RT-PCR were as follows: circERBB2IP-F 5’-CTGGATGTCAGCAAAAATGAATGTT-3’ and circERBB2IP-R 5’-TCGTAGACAGCGACATGGTA-3’; ERBB2IP-F 5’-TTTGTTGAGCAGGAGGGCCA-3’ and ERBB2IP-R 5’ -TCTACCGAAACGACCTCCGC-3’; GAPDH-F 5’-GGTTGTCTCCTGCGACTTCA-3’ and GAPDH-R 5’-TGGTCCAGGGTTTCTTACTCC-3’; ATCB-F 5’-GTGCTATGTTGCTCTAGACTTCG-3’ and ATCB-R 5’-ATGCCACAGGATTCCATACC-3’; U6-RT 5’-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAAAT-3’A, U6-F 5’-AGAGAAGATTAGCATGGCCCCTG-3’ and U6-R 5’-ATCCAGTGCAGGGTCCGAGG-3’;
miRNA was reverse transcribed with miRNA-specific stem-loop primers. The relative gene-expression levels were quantified using the 2–ΔΔCt method.
miRNA was reverse transcribed with miRNA-specific stem-loop primers. The relative gene-expression levels were quantified using the 2–ΔΔCt method.
4
Total RNA Isolation and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using RNAiso Plus (9108, Takara Bio, Kyoto, Japan). The cDNA was acquired with the PrimeScript RT kit (6210A, Takara Bio, Kyoto, Japan) according to the manufacturer’s instructions. Then, the synthesized cDNA was used as the template for qRT-PCR. Primers are shown in Table S3 . The qRT-PCR was performed in triplicate using SYBR Premix Ex TaqTM Kit (MF013, Mei5bio, Beijing, China). Relative expression values were calculated with the 2−ΔΔCt method. Values of gene expression were calculated as the means of three replicates and β-actin was used as a reference.
5
Quantification of Inflammatory Gene Expression in HUVECs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from HUVECs using TRIzol (Invitrogen Life Technologies, USA) in accordance with the manufacturer’s instructions. First-strand cDNA was synthesized using a PrimeScript RT Kit (Takara Biotechnology Co., Ltd., Dalian, China). A TaqMan Assay Kit (Thermo Fisher Scientific, Inc.) was used to perform RT-PCR. Then, the mRNA levels of IL-6, IL-8, and NOX-4 were detected using SYBR Green real-time PCR method. The amplification conditions for PCR were: denaturation at 95 °C for 10 s; 40 cycles at 95 °C for 5 s; 40 cycles at 60 °C for 20 s. The results are expressed as fold changes and were determined using the 2−ΔΔCT method [45 (link)]. The following primers were used in this study: IL-6: (Forward, 5’-AGGGCTCTTCGGGAAATGTA-3’, Reverse, 5’CTTGACGGTGCCATGGAATT3’); IL-8: (Forward, 5’-TTTCTGTTAAATCTGGCAACCCTAGT-3’, Reverse, 5’- ATAAAGGAGAAACCAAGGCACAGT-3’); NOX-4: (Forward, 5’-CAGATGTTGGGGCTAGGATTG-3’, Reverse, 5’- GAGTGTTCGGCACATGGGTA-3’). GAPDH: (Forward, 5’-ACTGGCGTCTTCACCACCAT-3’, Reverse, 5’-AAGGCCATG CCAGTGAGCTT-3’).
6
Quantifying Osteogenic and miRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol reagent (Invitrogen) was used to extract total RNA from tissues and cells. After RNA concentration was detected, a prime script RT Kit (Takara, Dalian, China) was used for reverse transcription. The expression of Alkaline Phosphatase (ALP), osteocalcin (OCN) and miR-100 was detected by RT-qPCR according to the protocol. The specific RT-qPCR cycle was as follows: 3 min at 95°C, 15 s at 95°C, 30 s at 60°C, 40 cycles. The SDS 1.3.1 (Sequence Detection Software) was used to create a relative quantification plate. The internal control of ALP and OCN was β-actin, while the internal control of miR-100 was U6. The specific primer sequence is shown in Table 1 .
Information of primers used in PCR
| Targets | Primers (5ʹ-3ʹ) | |
|---|---|---|
| ALP | F | GGGACTGGTACTCGGATAACGA |
| R | CTGATATGCGATGTCCTTGCA | |
| OCN | F | AAGCAGCAACGCTAGAAGACAG |
| R | GCGCCGGAGTCTGTTCACTA | |
| MTOR | F | GAGTGATGCAGCTCTTTGG |
| R | GTATCTCTGGATGCTGAGGT | |
| MiR-100 | F | GAGGAACCCGTATCCGAA |
| R | TAACCACCACACCAAACACA | |
| U6 | F | CTTGCTCCTCTTGGTCTGG |
| R | CTGGTCTCATGCCTGGG | |
| β-actin | F | CTGTCCCTGTATGCCTCTG |
| R | TGATGTCACGCACGATTT | |
7
Quantifying Target Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To detect the transcript levels of the target genes, total RNA was extracted from the brain and colon tissues of each group of mice. After the RNA concentration is determined, it is transcribed to cDNA using the PrimeScript™ RT kit (Takara, RR047A). RT-qPCR was performed using the TB Green Premix Ex Taq II Kit (Takara, RR820A). The program was 95 °C (30 s), followed by 40 cycles of 95 °C (5 s) and then 60 °C (34 s). Primers are listed in Supplementary Material Table S1 . Analyzed using the 2−ΔΔCt method [22 (link)].
8
Western Blot and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Radio-immunoprecipitation assay (RIPA) lysis buffer (50 mM Tris–HCl, pH 7.5, 150 mM NaCl, 1.0 mM EDTA, 0.1% sodium dodecyl sulfate, 1% sodium deoxycholate, and 1% Triton X-100) was used to prepare cell or frozen tissue protein lysates. The protein concentration was determined by using BCA protein assay kit (Thermo) following the instructions. Protein lysates were resolved on 10% SDS‒PAGE gels using standard procedures. Anti-Sp1 (106 kDa; Santa Cruz), anti-Pax7 (44‒50 kDa; Santa Cruz), anti-Cyclin D1 (37 kDa; Santa Cruz), anti-MEF-2C (40‒65 kDa; Santa Cruz), anti-MyoG (34 kDa; Santa Cruz), anti-MyHC (200 kDa; Santa Cruz), anti-p21 (21 kDa; Santa Cruz), anti-Tubulin (55 kDa; Sigma Aldrich), anti-GAPDH (36 kDa; Sigma Aldrich), and anti-HSP90 (90 kDa; Cell Signaling Technology) were used for western blot analysis.
Trizol reagent (Thermo) was used to extract total RNA from cells or frozen tissues according to the standard procedure. First strand cDNA was synthesized by using the PrimeScript RT kit (TaKaRa). The miRNAs were reverse transcribed by stem-loop RT system, which was performed as described previously (Liu et al., 2014 (link)). qPCR was performed on an ABI7900 Real Time PCR System (Applied Biosystems). The detailed information of PCR primers is inSupplementary Table S1 .
Trizol reagent (Thermo) was used to extract total RNA from cells or frozen tissues according to the standard procedure. First strand cDNA was synthesized by using the PrimeScript RT kit (TaKaRa). The miRNAs were reverse transcribed by stem-loop RT system, which was performed as described previously (Liu et al., 2014 (link)). qPCR was performed on an ABI7900 Real Time PCR System (Applied Biosystems). The detailed information of PCR primers is in
9
Quantitative mRNA Expression Analysis in Zebrafish
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For quantitative mRNA expression analysis, total RNA was isolated from 5 dpf
whole mount zebrafish embryos (15–20 embryos per sample) using TRIzol. cDNA
synthesis was performed with PrimeScript RT kit (Takara) and the primers
listed in Supplemental Table S1. qRT-PCR was carried out in LightCycler96
system (Roche Life Science) using the KAPA SYBR FAST qPCR kit (KAPA
Biosystems) using the following conditions: preincubation for 2 min at 50°C
and 10 min at 95°C, two-step amplification for 15 s at 95°C and 1 min at
60°C, for 40 cycles and three melting steps consisting of 60 s at 95°C, 60 s
at 65°C, and 10 s at 95°C. All RT-qPCR data are normalized to actin and
converted to linear data by the 2ΔCT method. Graphs represent
values normalized to control.
whole mount zebrafish embryos (15–20 embryos per sample) using TRIzol. cDNA
synthesis was performed with PrimeScript RT kit (Takara) and the primers
listed in Supplemental Table S1. qRT-PCR was carried out in LightCycler96
system (Roche Life Science) using the KAPA SYBR FAST qPCR kit (KAPA
Biosystems) using the following conditions: preincubation for 2 min at 50°C
and 10 min at 95°C, two-step amplification for 15 s at 95°C and 1 min at
60°C, for 40 cycles and three melting steps consisting of 60 s at 95°C, 60 s
at 65°C, and 10 s at 95°C. All RT-qPCR data are normalized to actin and
converted to linear data by the 2ΔCT method. Graphs represent
values normalized to control.
10
Quantitative Analysis of Chondrocyte Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The gene expressions of matrix metalloprotein 3 (MMP3), matrix metalloprotein 13 (MMP13), interleukin-6 (IL-6), interleukin-1β (IL-1β), and collagen II (COL2a1) were conducted by quantitative real-time polymerase chain reaction (qRT-PCR) assay. The total RNA in chondrocytes was isolated using a HiPure Total RNA Mini kit (Magen, Guangzhou, China), and complementary DNA (cDNA) was synthesized with Prime Script™ RT kit (Takara, Japan). The qRT-PCR reaction was carried out using a real-time PCR system (LightCycler®480, Roche, Germany), and melting curve data were used to evaluate PCR specificity. The relative gene expression levels were analyzed by the 2−ΔΔ CT method with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a control. All specimens were repeated three times. The primers in the qRT-PCR reaction are shown in Table 1 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!