Trizol regent

Manufactured by Thermo Fisher Scientific

Sourced in United States, China, Japan, Germany

TRIzol reagent is a total RNA isolation solution. It is a ready-to-use reagent designed for the isolation of high-quality total RNA from a variety of biological samples, including cells, tissues, and biofluids.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

TRIzol (38370 citations) TRIZOL regent kit (4 citations) TRIzol LS regent (2 citations)

428 protocols using trizol regent

RNA Sequencing Library Preparation Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from each sample using the TRIzol regent (Invitrogen, Carlsbad, CA, USA). The purity, concentration, and integrity of the RNA were checked using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA) and an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA), respectively. The RNA integrity number (RIN) of all samples was >6.5, OD260/280 ≥ 1.8.
Approximately 3 µg of RNA was used per sample to construct a complementary DNA (cDNA) library, according to the following procedures: the ribosome RNA (rRNA) was removed and strand-specific RNA-Seq libraries were subsequently using rRNA-depleted RNA. After RNA fragmentation, the double-stranded cDNA was synthesized by replacing dTTPs (deoxythymidine triphosphate) with dUTPs (deoxyuridine triphosphate) in a reaction buffer used for second-strand cDNA synthesis. The resulting double-stranded cDNA was ligated to adaptors, after being end-repaired and A-tailed. Single-strand cDNA was then obtained using USER (Uracil-Specific Excision Reagent) Enzyme (NEB, Ipswich, UK). Finally, a polymerase chain reaction (PCR) was performed to enrich the cDNA libraries. Sequencing was performed on an Illumina Hiseq 2500 instrument using the TruSeq Cluster Kit v3-cBot-HS (Illumina, San Diego, CA, USA) to generate 150 bp paired-end reads.

Yin X., Fang W., Yuan M., Sun H, & Wang J. (2023). Transcriptome Analysis of Leg Muscles and the Effects of ALOX5 on Proliferation and Differentiation of Myoblasts in Haiyang Yellow Chickens. Genes, 14(6), 1213.

+ Open protocol

+ Expand

Total RNA Extraction and RT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from hMCs using TRIzol regent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer’s protocol. Total RNA was reverse transcribed to cDNA using the PrimeScript reverse transcription reagent kit (Takara Biotechnology Co., Dalian, China). RT-PCR was performed using the TaqMan Universal PCR Master Mix kit (Thermo Fisher Scientific, Inc.). U6 served as an internal control. The 2^−ΔΔCq method was performed for relative gene expression quantification [13 (link)]. Each analysis was repeated at least 3 times.

Cao Y., Cao X., Sun L, & Lv Y. (2019). miR-206 Inhibits Cell Proliferation and Extracellular Matrix Accumulation by Targeting Hypoxia-Inducible Factor 1-alpha (HIF-1α) in Mesangial Cells Treated with High Glucose. Medical Science Monitor : International Medical Journal of Experimental and Clinical Research, 25, 10036-10044.

+ Open protocol

+ Expand

Quantitative PCR analysis of miRNA and mRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from tissue and cultured cells was isolated using TRIZOL Regent (Invitrogen). Quantitative polymerase chain reaction (PCR) primers were purchased from Guangzhou Genecopoeia Company. The primer sequences are shown as follows: miR-204-p: 5′-UUCCCUUUGUCAUCCUAUGCCU-3′; U6: F: 5′-GAGGCACAGCGGAACG-3′, R: 5′-CTACCACATAGTCCAGG-3′; ZNF521, F: 5′-TGACACCTCTGAGCCTAT-3′; R: 5′-TTTCTTTTTCACGATGGCACTTTCT-3′. The results were calculated by 2^−ΔΔCt method.

Huan C., Xiaoxu C, & Xifang R. (2019). Zinc Finger Protein 521, Negatively Regulated by MicroRNA-204-5p, Promotes Proliferation, Motility and Invasion of Gastric Cancer Cells. Technology in Cancer Research & Treatment, 18, 1533033819874783.

+ Open protocol

+ Expand

Quantification of miR-299-3p Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Trizol regent (Invitrogen) was employed to extract the total RNA from cell lines according to the provided protocols. M-MLV Reverse Transcriptase (Invitrogen) was used to reverse the transcribed RNA into complementary DNA. Quantitative real-time polymerase chain reaction (qRT-PCR) was performed on Applied Biosystems 7500 (Applied Biosystems, Foster City, California) using SYBR Premix Ex Taq (TaKaRa, Dalian, China) with the following primers: miR-299-3p: 5′-ACACTCCAGCTGGGTATGTGGGATGGTAAAC-3′ (forward) and 5′-GTGCAGGGTCCGAGGT-3′(reverse); U6 small nuclear RNA (snRNA): 5′-CTCGCTTCGGCAGCACA-3′ (forward) and 5′-AACGCTTCACGAATTTGCGT-3′ (reverse). Relative miR-299-3p expression levels were calculated using 2^−ΔΔCt method with U6 snRNA as internal control.

Xu Y., Liu Y., Xiao W., Yue J., Xue L., Guan Q., Deng J, & Sun J. (2019). MicroRNA-299-3p/FOXP4 Axis Regulates the Proliferation and Migration of Oral Squamous Cell Carcinoma. Technology in Cancer Research & Treatment, 18, 1533033819874803.

+ Open protocol

+ Expand

Quantifying OsLHT1 expression in rice

Check if the same lab product or an alternative is used in the 5 most similar protocols

To investigate the expression pattern of OsLHT1, total RNA was extracted from different organs of 14-week-old WT rice using Trizol regent (Invitrogen). Reverse transcription was performed using 1μg of total RNA and the first-strand cDNA was reverse transcribed using superscript reverse transcriptase (Invitrogen) according to the manufacturer’s instructions. The primers 5′-TCTTCGGTGGATTCGCCTTC-3′ and 5′-ATGATGCAGATCCAGTTGGTG-3′ for OsLHT1, 5′-GGTCAACTTGTTGATTCCCCTCT-3′ and 5′-AACCGCAAAATCCAAAGAACG-3′ for Histone were used for qRT-PCR, and conditions for quantitative analysis were as follows: 94 °C for 2 min, 35 cycles of 94 °C for 15 s, 60 °C for 20s and 72 °C for 30s and final extension at 72°Cfor 10 min. The gene transcript levels in each sample were normalized to that of the housekeeping gene Histone. Each experiment was conducted with three biological replicates.

Wang X., Yang G., Shi M., Hao D., Wei Q., Wang Z., Fu S., Su Y, & Xia J. (2019). Disruption of an amino acid transporter LHT1 leads to growth inhibition and low yields in rice. BMC Plant Biology, 19, 268.

+ Open protocol

+ Expand

Quantitative Analysis of miR-138-5p

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from GC tissues or cells using the TRIzol regent (Invitrogen, Thermo Fisher Scientific, Inc., Waltham, MA, USA) according to the manufacturer’s guidelines. RNA concentration was determined with the NanoDrop 2000 spectrophotometer (NanoDrop Technologies, Thermo Fisher Scientific, Inc., Waltham, MA, USA). One microgram of total RNA was reversely transcribed into cDNA using the TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems, Thermo Fisher Scientific, Inc., Waltham, MA, USA). The qPCR analysis of miR-138-5p was performed with the TaqMan miRNA PCR kit (Applied Biosystems, Thermo Fisher Scientific, Inc., Waltham, MA, USA) using the Option RT-PCR detection system (ABI 7500, Thermo Fisher Scientific, Inc., Waltham, MA, USA). The level of U6 RNA was detected for the normalization. The amplifying reaction was performed with the following conditions: pre-degeneration at 95ºC for 30 sec, followed by denaturation at 95ºC for 5 sec, annealing at 62ºC for 30 sec for 40 cycles. The relative expression of miR-138-5p was determined with the 2^−ΔΔCT method.

Zhang W., Liao K, & Liu D. (2020). MiR-138-5p Inhibits the Proliferation of Gastric Cancer Cells by Targeting DEK. Cancer Management and Research, 12, 8137-8147.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Circular RNA and miRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from sample tissues and cells using TRIzol regent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s specification. Total RNA was reverse transcribed with Prime Script TM RT reagent Kit with gDNA Eraser (TaKaRa, Dalian, Liaoning, China). The quantitative RT-PCR was performed with SYBR- Green PCR Master Mix kit (Takara, Japan) on a StepOne Plus real time PCR system (Applied Biosystems, Foster City, CA, USA). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was an internal control and U6 was used as the control of miR-26a-5p based on the comparative Ct method (2^−ΔΔCt). The primer sequences used for qRT-PCR and the sequence of miR-26a-5p were as the following:
TGF-β1
Forward Primer: 5′GGCCAGATCCTGTCCAAGC3′
Reverse Primer: 5′GTGGGTTTCCACCATTAGCAC3′
Circ_0051079
Forward Primer: 5′TTTGGCAAAGTCATCCTGGT3′
Reverse Primer: 5′TGGTACGCTGTCACCTAGCTC3′
Circ_0011038
Forward Primer: 5′GAGAAAGGCTGGGTCTTGG3′
Reverse Primer: 5′AGTCAAGGCTGCCGTTCTT3′
Circ_0070372
Forward Primer: 5′CAGCAGCAGAAAGTGGAAAA3′
Reverse Primer: 5′ACTGCCAGTGCTGATTGCT3′
Circ_0035114
Forward Primer: 5′TGCGAGAAACCTTCCTCAAC3′
Reverse Primer: 5′GGAGCAGCTCTAGCCAGGAT3′
miR-26a-5p.1
Forward Primer: 5′GCAGTTCAAGTAATCCAGGATAG3′
Reverse Primer: 5′GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGAC3′.

Zhang Z., Zhao M, & Wang G. (2019). Hsa_circ_0051079 functions as an oncogene by regulating miR-26a-5p/TGF-β1 in osteosarcoma. Cell & Bioscience, 9, 94.

+ Open protocol

+ Expand

Quantitative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted form leukocytes, atherosclerotic plaques and cultured cells using TRIZOL Regent (Invitrogen, Carlsbad, CA) and cDNA synthesis was performed with a HiScript® 1st strand cDNA Synthesis Kit (Nanjing Vazyme Biotech Co., Ltd., Nanjing, China). Five nanograms of cDNA were used for real-time reactions using ChamQTM SYBR® qPCR Master Mix (Nanjing Vazyme Biotech Co., Ltd., Nanjing, China) and a ViiATM 7 Real-time PCR System (Applied Biosystems). Relative gene expression levels were calculated using the comparative crossing threshold method of relative quantification (ΔCq) and fold change (FC) values. ΔCq was designated as the mean Cq (mean of duplicates) of a target gene subtracted by the mean Cq (mean of duplicates) of a reference gene (GAPDH). Based on recommendations from the manufacturer, the Cq expression cut-off was set to 30; this was applied to all calculations. In order to compare mean expression levels between the CAD group and the control group, FC was designated as 2-ΔCq. Detailed primer information and qPCR data processing are shown in Additional file 1: Table S1.

Peng C., Lei P., Li X., Xie H., Yang X., Zhang T., Cao Z, & Zhang J. (2019). Down-regulated of SREBP-1 in circulating leukocyte is a risk factor for atherosclerosis: a case control study. Lipids in Health and Disease, 18, 177.

+ Open protocol

+ Expand

Quantifying MSNP1AS Expression in Mouse Brain

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from wild-type and BAC transgenic mouse brain tissues by using Trizol Regent (Invitrogen) and High Pure RNA Tissue Kit (Roche), as described in the manufacturer’s protocols. cDNA was generated by the use of ReverTra Ace qPCR RT Master Mix with gDNA Remover (TOYOBO) according to the manufacturer’s protocol. qPCR assays were performed with TaqMan Gene Expression Assays (Applied Biosystems) running on a ABI 7900HT system and the data was analyzed with SDS2.1 software. The probe for MSNP1AS had already been designed by Campbell’s Lab7 to target the most divergent sequence between MSNP1AS and the mature MSN transcript, and was custom-synthesized by Applied Biosystems. TaqMan Gene Expression Assay for Msn (assay ID Mm00447889_m1), LacZ (assay ID Mr00529369_cn) and Gapdh (assay ID Mm99999915_g1) were also purchased from Applied Biosystems. All results presented represent normalization to Gapdh (glyceraldehyde-3-phosphate dehydrogenase) expression.
For each time point (E17.5-P7) and each brain structure (somatosensory cortex, striatum, cerebellum), 4 independent mouse brain tissues were used to extract total RNA. All qPCR reactions were performed in triplicate. Pearson correlation coefficient (r) and P value between LacZ mRNA expression and MSNP1AS RNA expression were calculated by using Microsoft Excel 2011 statistical tools.

Inoue Y.U, & Inoue T. (2016). Brain enhancer activities at the gene-poor 5p14.1 autism-associated locus. Scientific Reports, 6, 31227.

+ Open protocol

+ Expand

Baseline Expression of PmMuGST in Shrimp Tissues

Check if the same lab product or an alternative is used in the 5 most similar protocols

To investigate the basal (control) mRNA level of PmMuGST in various tissues, total RNA was extracted from eight tissues, including hemocytes, hepatopancreas, muscle, heart, ovary, stomach, eyestalk and intestine, from three healthy P. monodon using Trizol regent (Invitrogen, UAS). The amount of PmMuGST mRNA in the different tissues was determined by quantitative real-time PCR (RT-PCR). The RNA samples were analyzed in 1.0 % agarose electrophoresis and quantitated at 260 nm, and all OD₂₆₀/OD₂₈₀ ratios were between 1.8 and 2.0. Total RNA (1 μg) was reverse transcribed using the PrimeScript™ Real time PCR Kit (TaKaRa, Otsu, Shiga, Japan) for real-time quantitative RT-PCR analysis. Elongation factor 1-alpha (EF1A) of P. monodon (GenBank accession no. GU136229) was used as an internal control.

Wang Y., Liu L., Huang J., Duan Y., Wang J., Fu M, & Lin H. (2016). Response of a Mu-class glutathione S-transferase from black tiger shrimp Penaeus monodon to aflatoxin B1 exposure. SpringerPlus, 5(1), 825.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!