Plko 1 hygro

The Brunello knockout pooled library was a gift from David Root and John Doench (Addgene #73178). psPAX2 was a gift from Didier Trono (Addgene plasmid # 12260). pCMV-VSV-G was a gift from Bob Weinberg (Addgene plasmid #8454). lentiCRISPRv2puro was a gift from Brett Stringer (Addgene plasmid #98290). lentiGuide-puro was a gift from Feng Zhang (Addgene plasmid #52963). pFUGW-EFSp-Cas9-P2A-Zeo (pAWp30) was a gift from Timothy Lu (Addgene plasmid #73857). pLenti CMV GFP Puro (658-5) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid #17448). mitoBFP was a gift from Gia Voeltz (Addgene # 49151). pGW1-mCherry-EGFP-PIM was a gift from Lukas Kapitein (Addgene plasmid #111759). pHAGE-mt-mKeima was a gift from Richard Youle (Addgene plasmid #131626). pLKO.1 hygro was a gift from Bob Weinberg (Addgene plasmid # 24150) Other vectors generated during this study are available upon request.

A vector expressing the shRNA of FAK (SHCLING‐NM_005607) was purchased from Sigma. They included five different clones (TRCN0000196310, TRCN0000194984, TRCN0000121318, TRCN0000121207, and TRCN0000121209) to inhibit expression of FAK. For the construction of vectors expressing shRNA of IGF‐IR, three oligos were prepared with the following sequences: IGF‐IR‐1, 5′‐CCGGGCCTTTCACATTGTACCGCATCTCGAGATGCGGTACAATGTGAAAGGCTTTTTG‐3′ (forward) and 5′‐AATTCAAAAAGCCTTTCACATTGTACCGCATCTCGAGATGCGGTACAATGTGAAAGGC‐3′ (reverse); IGF‐IR‐2, 5′‐CCGGGCCGAAGATTTCACAGTCAAACTCGAGTTTGACTGTGAAATCTTCGGCTTTTTG‐3′ (forward) and 5′‐AATTCAAAAAGCCGAAGATTTCACAGTCAAACTCGAGTTTGACTGTGAAATCTTCGGC‐3′ (reverse); IGF‐IR‐3, 5′‐CCGGCGGCAACCTGAGTTACTACATCTCGAGATGTACTAACTCAGGTTGCCGTTTTTG‐3′ (forward) and 5′‐AATTCAAAAACGGCAACCTGAGTTACTACATCTCGAGATGTAGTAACTCAGGTTGCCG‐3′ (reverse).
They were subcloned into pLKO.1 hygro (Addgene). Human epithelial kidney 293T cells were transfected with helper retrovirus and retroviral plasmids using FuGENE 6 Transfection Reagent (Promega). Retroviruses expressing shRNA were harvested 24‐60 hours after transfection and stored on ice.27 The transfected TC71 cells bearing the lowest FAK and IGF‐IR expression by real‐time quantitative reverse transcription‐polymerase chain reaction (RQ‐RT‐PCR) and western blotting were used for gene expression analysis.

Oligonucleotides containing shRNA sequences targeting A3A, A3B, and a non-targeting scrambled sequence were cloned into pLKO.1 hygro (Addgene, #24150) to create lentiviral shRNA expression plasmids pTM-66 (A3A-shRNA), pTM-382 (A3B-shRNA-1), pTM-383 (A3B-shRNA-2), and pTM-238 (non-targeting shRNA). Plasmids psPAX2 (Addgene, #12260), pMD2.G (Addgene, #12259), and individual lentiviral shRNA plasmids were co-transfected into HEK293T cells for production of lentivirus. All the shRNA target sequences and oligonucleotides used for cloning are listed in S5 Table. Cell-free lentiviral supernatant was collected and used to transduce target cells in the presence of 8 μg/mL polybrene (MilliporeSigma) or Lentiblast transduction reagent (OZ biosciences), which was diluted 1:250 into lentiviral supernatant. Stable cell populations were selected with HygromycinB at concentrations listed in S4 Table. Although there are three mismatches between A3B-shRNA-1 and the A3A transcript-1 mRNA sequence, this shRNA, which is equivalent to Broad Institute TRCN0000140546, reduced A3A expression (S4 Fig). Therefore, pTM-383 (A3B-shRNA-2) was used for all A3B knockdown experiments.

shRNAs in pGIPz vector backbones were synthesized by UT MD Anderson Cancer Center Functional Genomics Core. To generate inducible shRNA plasmids, shRNAs were subcloned from pGIPz to pTRIPz vector backbones using MluI and XhoI enzymes. pLKO.1 hygro was purchased from Addgene (plasmid no.: 24150; Addgene). shRNA sequences targeting 3′-UTR regions of PHF20 and PHF20L1 were taken from Sigma MISSION shRNA design (Sigma–Aldrich). Chosen shRNA sequences were subcloned into pLKO.1 hygro vector backbone using AgeI and EcoRI restriction sites. shRNA sequences used in this study are listed in Table S2.