A lentiviral vector was co-transfected with psPAX2 and pMD2G (Cellecta, Mountain View, CA, USA) into HEK293T cells using polyethylenimine (PEI, Sigma, St. Louis, MO, USA) (6 μg PEI/μg plasmid) to generate lentivirus expressing miR-193b or the control. The pENTR-miRNA vector or miR-con was switched into an adenovirus vector using the Gateway technique pAd/CMV/V5-DEST™ (Invitrogen, Carlsbad, CA, USA) as described by the manufacturer. Adenoviral vectors were then linearized with PacI before they were transfected to HEK293A cells. The virus was harvested and further amplified by re-infecting HEK293A cells. The adenovirus was eventually purified using the Adeno-X™ Maxi Purification Kit (Clontech, Mountain View, CA, USA) according to the manufacturer’s instructions. Infectious units (IU) of both lenti- and adeno-miRNA viruses were determined by titration in HEK293T cells.
Pmd2 g
Manufactured by Cellecta
Sourced in United States
The PMD2.G is a lab equipment product that serves as a programmable, multi-channel peristaltic dispenser. It can accurately deliver precise volumes of liquids across multiple channels simultaneously.
Automatically generated - may contain errors
Lab products found in correlation
Pspax2, by Cellecta (5 mentions)
Pad cmv v5 dest, by Thermo Fisher Scientific (2 mentions)
Adeno x maxi purification kit, by Takara Bio (2 mentions)
Polyethylenimine (pei), by Merck Group (2 mentions)
Lenti x concentrator, by Takara Bio (2 mentions)
Stbl3 chemically competent cells, by Thermo Fisher Scientific (1 mentions)
Lenti x 293t cells, by Takara Bio (1 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)
5 protocols using pmd2 g
1
Lentiviral and Adenoviral Transduction Protocols
2
Generating Lentiviral and Adenoviral Vectors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A lentiviral vector was cotransfected with psPAX2 and pMD2G (Cellecta, Mountain View, CA, USA) into HEK293T cells using polyethylenimine (PEI, Sigma, St. Louis, MO, USA; 6 μg PEI/μg plasmid) to generate lentivirus expressing miR‐193b or the control. The pENTR‐miRNA vector or miR‐con was switched into an adenovirus vector using the Gateway technique pAd/CMV/V5‐DEST™ (Invitrogen, Carlsbad, CA, USA) as described by the manufacturer. Adenoviral vectors were then linearised with PacI before they were transfected to HEK293A cells. The virus was harvested and further amplified by reinfecting HEK293A cells. The adenovirus was eventually purified using the Adeno‐X™ Maxi Purification Kit (Clontech, Mountain View, CA, USA) according to the manufacturer's instructions. Infectious units of both lenti‐ and adeno‐miRNA viruses were determined by titration in HEK293T cells.
3
Inducible shRNA Lentiviral Delivery
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
shRNA sequences were originated from the Broad GPP Portal (TDP-43: AGATCTTAAGACTGGTCATTC, scramble: GATATCGCTTCTACTAGTAAG). To clone, complementary oligonucleotides were synthesized to generate 4-nt overhangs, annealed and ligated into pRSITCH (Tet inducible U6) or pRSI16 (constitutive U6) (Cellecta). Ligations were transformed into Stbl3 chemically competent cells (Thermo Scientific) and grown at 30 °C. Large scale plasmid generation was performed using Maxiprep columns (Promega), with purified plasmid used as input for lentiviral packaging with second generation packaging plasmids psPAX2 and pMD2.G (Cellecta), transduced with Lipofectamine 2000 (Invitrogen) in Lenti-X 293T cells (Takara). Viral supernatant was collected at 48 and 72 h post transfection and concentrated using Lenti-X Concentrator (Takara). Viral titer was established by serial dilution in relevant cell lines and readout of percentage of BFP+ cells by flow cytometry, with a dilution achieving a minimum of 80% BFP+ cells selected for experiments.
4
Lentiviral Pooled shRNA Library Production
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The shRNA screen was conducted using the Decipher module 3 pooled shRNA library (Cellecta Inc.), which contains 27500 shRNAs targeting 4922 human genes (i.e., 5–6 shRNAs per gene). The library was prepared as lentiviral particles by co-transfection of HEK293T cells with second-generation packaging plasmids psPAX2 and pMD2.G (Cellecta Inc.) using Lentifectin transfection reagent (Biocat, Germany). Lentiviral particles were harvested after 72 h and concentrated using Lenti-X concentrator (Takara Clontech).
5
Lentiviral Vector Expressing miR-155
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!