The largest database of trusted experimental protocols

Sirna

Manufactured by Genomed
Sourced in China

SiRNA is a laboratory equipment designed to facilitate the delivery of small interfering RNA (siRNA) molecules into cells. siRNA is a technique used to silence the expression of specific genes by targeting and degrading the corresponding mRNA. The core function of SiRNA is to provide a reliable and efficient method for introducing siRNA into cells, enabling researchers to study gene function and explore potential therapeutic applications.

Automatically generated - may contain errors

23 protocols using sirna

1

GAS6 and AXL Knockdown in Astrocytes and BV2 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
BV2 cells or primary cultured astrocytes were transiently transfected with siRNA targeting GAS6 (100 nM), siRNA targeting AXL (100 nM), or control siRNA (Genomeditech, Shanghai, China) using 7.5 μL of Lipofectamine™ 3000 (Invitrogen, California, USA) according to the manufacturer’s protocol. The cells were incubated in Opti-MEM for 48 h, then changed to astrocyte culture and continually incubated for 24 h, and the GAS6 knockdown BV2 supernatant fluid was collected for the next step. The sequences used for GAS6 knockdown were sense 5-CGGAGUAUUUCUAUCCACGAU-3 and antisense 5-AUCGUGGAUAGAAAUACUCCG-3; the sequences used for AXL knockdown was sense 5-GGAGACCCGUUAUGGAGAATT-3 and antisense 5-UUCUCCAUAACGGGUCUCCTT-3.
+ Open protocol
+ Expand
2

Silencing and Overexpressing PAX6 in A549 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
PAX6 was silenced in A549 cells with siRNA (RiboBio Co., Ltd., Guangzhou, China), according to the manufacturer’s instructions; the target sequences were as follows: si-h-PAX6_001, GCGACTCCAGAAGTTGTAA; si-h-PAX6_002, GCAGACGGCATGTATGATA; si-h-PAX6_003, GCTTCACCATGGCAAATAA. The corresponding negative control was purchased from RiboBio Co., Ltd. To stably knock down PAX6 in cells, siRNA targeting the si-h-PAX6_002 coding sequence 5′-GCAGACGGCATGTATGATA-3′ was designed and inserted into a pGMLV-SC5RNAi lentiviral vector (Genomeditech Co., Ltd, Shanghai, China); a scramble siRNA was used as a negative control.
To overexpress PAX6 in cells, an expression construct was generated by subcloning PCR-amplified, full-length human PAX6 cDNA into a pGMLV-CMV-PAX6 lentiviral vector (Genomeditech); an empty vector was used as the negative control. These procedures were performed, as described previously.24 (link) The knockdown and overexpression efficiencies were evaluated by quantitative reverse transcription PCR (RT-qPCR) and western blotting.
+ Open protocol
+ Expand
3

Lnc-MMP2-2 Modulates HBMEC Function

Check if the same lab product or an alternative is used in the 5 most similar protocols
The NSCLC cell line A549 was obtained from Cell Bank of the Chinese Academy of Sciences (Shanghai, China). Non-fetal-derived human brain microvascular endothelial cells (HBMECs) were purchased from Bioleaf Biotechnology (Shanghai, China). A549 and HBMECs were grown in Roswell Park Memorial Institute-1640 medium (Invitrogen, Carlsbad, CA, USA) containing 10% fetal bovine serum at 37 °C with 5% CO2. The lnc-MMP2-2 overexpression and silencing lentivirus and their control lentivirus were packaged by Genomeditech (Shanghai, China). EPB41L5-targeting siRNA and scramble control siRNA were obtained from Ribobio (Guangzhou, China). The EPB41L5-targeting sequences were as follows: siRNA#1, 5′-GGATCACGATTTA GATATA-3′; siRNA#2, 5′-GTCCTGAACTTGTCTCAGA-3′; siRNA#3: 5′-CGACTATTTTGGTCTGAG A-3′. The overexpression plasmid (pcDNA3.1-EPB41L5) and the empty vector (pcDNA3.1) were obtained from Genomeditech (Shanghai, China). miR-1207-5p antagomir, antagomir control, and miR-1207-5p agomir and agomir control were purchased from Ribobio (Guangzhou, China). Cell transfection was performed using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s instructions. For exosome transfection, lnc-MMP2-2 Smart Silencer (RiboBio Co, Ltd., Guangzhou, China) were loaded in exosomes using the Exo-Fect Exosome Transfection Kit.
+ Open protocol
+ Expand
4

Overexpressing and Silencing Circβ-catenin

Check if the same lab product or an alternative is used in the 5 most similar protocols
Circβ‐catenin overexpressing vector (Lv‐circβ‐catenin), HA‐Tag labeling circβ‐catenin overexpressing vector (Lv‐HA‐circβ‐catenin), HA‐Tag labeling plasmid (Lv‐HA‐NC), and negative control plasmid (Lv‐NC) were generated by Genomeditech, Shanghai, China. Circβ‐catenin expression was instantly a knockdown by human circβ‐catenin‐specific small interference RNAs (siRNAs), which were generated from Genomeditech, Shanghai, China. Vectors were transfected with Lipofectamine 3,000 transfection reagent. After 48 h, cells were used to the follow‐up experiments.
+ Open protocol
+ Expand
5

HMGB1 Knockdown and Overexpression Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were seeded in a 6-well plate with a density of 1.0 × 104 per well. Cells were transfected with siRNAs (Genomeditech, Shanghai, China) using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) or infected with prepared HMGB1 virus (Genechem, ShangHai, China) at different MOI respectively in accordance with the manufacturers’ instructions. The transfection or infection effects were detected by RT-PCR and Western blot. The siRNA sequences are listed as follows: HMGB1-siRNA-1: sense 5′-GGAGAGAUGUGGAAUAACAtt-3′and antisense 5′-UGUUAUUCCACAUCUCUCCtt-3′; HMGB1-siRNA-2: sense 5′-CCAUUGGUGAUGUUGCGAAtt-3′and antisense 5′-UUCGCAACAUCACCAAUGG-3′.
+ Open protocol
+ Expand
6

Molecular Tools for NKAP Regulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
NKAP-targeting short hairpin RNAs (ACAGUGACUCUGAUUCUGAAACAGA for humans and GGAAAUCUAGUCAUUCAAAAGACAG for mouse) and a nonspecific control (scramble, TTCTCCGAACGTGTCACGT) were constructed using a pGMLV-hU6-MCS-CMV-Blasticidin-WPRE lentiviral vector. The pGMLV-CMV-MCS-3xFLAG-PGK-Puro vector was used to construct an NKAP-overexpressing Lentivirus. The pGMLV-CMV-MCS-EF-ZsGreen1-T2A-Puro vector was used to construct a SLC7A11 overexpressing plasmid. A short interfering RNA (siRNA) was used to target METTL3 (GGACCAAGGAAGAGUGCAU), U2AF2 (GAAACACCUCAAGUGGAGACA), SFPQ (GGAAAGACAAGCAUUAGAAA), and SLC7A11 (CCAUUAUCAUUGGCACCAUTT). Lentivirus, plasmid, and siRNAs were purchased from Genomeditech, Shanghai, China.
+ Open protocol
+ Expand
7

Gene Silencing via siRNA Transfection

Check if the same lab product or an alternative is used in the 5 most similar protocols
Transfection of small interfering RNAs (siRNAs) (Genomeditech, Shanghai, China) was performed with LipofectamineTM 3000 Transfection Reagent following the manufacturer’s protocols. Three short (50 nmol/L) siRNAs targeting specific gene sequences (Supplementary Table 1) were used to transfect cells. siRNAs that caused significant knockdown effects were used in subsequent analyses.
+ Open protocol
+ Expand
8

Investigating transcription factor regulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Small interfering RNAs (siRNAs) targeting human Myc, JUN, IRF1, IRF3, STAT1, STAT3 and RNF146 were synthesized by Genomeditech (Shanghai, China). PGMLV-CMV-H_PARG-3×Flag-EF1-ZsGreen1-T2A-Puro overexpression plasmid vector was constructed by Genomeditech (Shanghai, China). CMV-PARP1-EGFP-SV40-Neomycin overexpression plasmid vector and Ubi-H_TLR9-3FLAG-SV40-EGFP overexpression and hU6-TLR9-Ubiquitin-EGFP-IRES-puromycin knockdown lentiviral vectors was constructed by GeneChem Co., Ltd (Shanghai, China).
+ Open protocol
+ Expand
9

Knockdown and Overexpression of UBAP2L

Check if the same lab product or an alternative is used in the 5 most similar protocols
To knock down the expression of UBAP2L, three small interfering RNAs (siRNAs) targeting UBAP2L and the parental negative control (NC) were synthesized by Genomeditech (Shanghai, China). RFect reagent (Baidai, China) was used for transfection according to the manufacturer’s protocol. Ectopic UBAP2L overexpression lentivirus was constructed according to the human UBAP2L full-length sequence by Genomeditech (Shanghai, China), and an empty vector was used as the control. Lentivirus infection was performed according to the manufacturer’s instructions. Western blotting and quantitative real-time PCR were used to validate transfection efficiency. The sequences of siRNA and full-length UBAP2L are provided in the Supplementary Materials.
+ Open protocol
+ Expand
10

Plasmid and siRNA Transfection Protocols

Check if the same lab product or an alternative is used in the 5 most similar protocols
Transfection of plasmids was performed using Lipofectamine 3000 reagent (Invitrogen, USA) according to the manufacturer’s instructions. Transfection of siRNA (Genomeditech, China) or miRNA mimics or inhibitors (Ribobio, China) was performed using Lipofectamine RNAiMAX (Invitrogen, USA) at a final concentration of 100 nM. Sequences of siRNA against specific targets in this study were listed in Additional file 7: Table S9.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!