Puc57 kan vector

The xynA gene from P. citrinum FERM P-15944 was synthesized with codon optimization for expression in P. pastoris based on the nucleotide database (GenBank: accession no. AB198065.1) [21 (link)] and introduced into the pUC57-Kan vector by GenScript (Piscataway, NJ, USA). The P. pastoris expression kit, including the P. pastoris strain X-33, constitutive expression vector (pGAPZα A), methanol-inducible expression vector (pPICZα A) and Zeocin were all from Invitrogen (Carlsbad, CA, USA). All restriction enzymes and Phusion High-Fidelity DNA polymerase were from New England BioLabs (Beverly, MA, USA). Birchwood xylan was from Sigma-Aldrich (St Louis, MO, USA), Azo-xylan was from Megazyme (Wicklow, Ireland).
Pichia pastoris was cultured in YPD medium 1% (w/v) yeast extract, 2% (w/v) bacteriological peptone and 2% (w/v) dextrose at 30 °C with shaking at 200 rpm. The transformants were selected on YPDS plates (YPD with 1 M sorbitol) containing 100–2000 µg/mL Zeocin. The pGAPZα A transformants were chosen for preliminary selection on YP (YPD without dextrose) with 0.2% (w/v) Azo-xylan.
Escherichia coli DH5α (Gibco) was used for vector propagation and was grown in a Luria-Bertani (LB) medium at 37 °C with either kanamycin (50 µg/mL) to select for pUC57-Kan or Zeocin (25 µg/mL) to select for pGAPZα A and pPICZα A transformants.

The same sequential digestions and ligation as for the making of the pUbiattB-CIGAR^eGFP were used for the construction of the pUbiattB-CIGAR^mCherry. The only difference was in the design of the target site; the gRNA (sgRNA-2) has a different unique target sequence and contains the mCherry gene as the fluorescent marker. The insert ligated into the pUC57-Kan vector was ordered from GenScript.
The CIGAR^mCherry insert:
5′-KpnI_CAACATGGTGCAACATGGTGCAACATGGTGCCCCGAGACAAGCACCTGACGGGACGATAGGCTGCAGATCCTTGGCGCGCCTTCAGGAGGCGGTGCTACTGCTGGCGCTGGTGGAGCCGGTGGACCTGCGGGGTTAATTGTGAGCAAGGGCGAGGAGGACAACATGGCCATCATCAAGGAGTTCATGCGCTTTAAGGTGCACATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCAAGGGCGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCTCAGTTCATGTACGGCTCCAAGGCCTACGTGAAGCACCCCGCCGACATCCCCGACTACTTGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACGGCGAGTTCATCTACAAGGTGAAGCTGCGCGGCACCAACTTCCCCTCCGACGGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCTCCGAGCGGATGTACCCCGAGGACGGCGCCCTGAAGGGCGAGATCAAGCAGAGGCTGAAGCTGAAGGACGGCGGCCACTACGACGCCGAGGTCAAGACCACCTACAAGGCCAAGAAGCCCGTGCAGCTGCCCGGCGCCTACAACGTCAACATCAAGCTGGACATCACCTCCCACAACGAGGACTACACCATCGTGGAACAGTACGAGCGCGCCGAGGGCCGCCACTCCACCGGCGGCATGGACGAGCTGTACAAGTAA_EcoRI-3′.

Synthetically synthesized sequences for porcine IFNα, IFNβ, SGLuc-IFNα and SGLuc-IFNβ were inserted into the pUC57kan vector (Genscript USA Inc) and subsequently cloned into a modified pTARGET™ vector (mpTarget) for mammalian expression. The sequence for IFNα was inserted into previously constructed Δ1D2A-SGLucΔ1M and SGLuc-Δ1D2A constructs for bi-cistronic vectors [11 (link)]. These constructs differ in whether the luciferase is on the N- or C- terminus of the Δ1D2A Foot-and-Mouth Disease Virus derived translational “skipping” mechanism. For the Δ1D2A-SGLucΔ1M construct the first methionine of SGLuc is also deleted. Plasmids were transformed into NEB® 5-α Competent E. coli (New England Biolabs) and plated on LB Agar plates with 100 μg/mL carbenicillin (Teknova, L1010). Selected colonies were grown in 4 mL of Terrific Broth with 100 μg/mL carbenicillin (Teknova, T7030) overnight at 37 °C, and plasmid purification was performed using QIAprep® Spin Miniprep kit (Qiagen, 27,106). Insertion was validated by sequence analysis using primers mpTarget-F (GACATCCACTTTGCCTTTCTCTC) and mpTarget-R (CTCATCAATGTATCTTATCATGTC). Recombinant plasmid DNAs were purified utilizing a EndoFree Plasmid Maxi kit (Qiagen, 12,362).