Quantitech reverse transcription kit

Total RNA was extracted using RNAqueous kit (Ambion, CA, USA). 1 μg of total RNA was reverse‐transcribed using Quantitech reverse transcription kit (Qiagen, West Sussex, UK). qRT–PCR was performed using SYBR green method on an ABI7500 cycler (Applied Biosystems, CA, USA). All primers were obtained from PrimerDesign (Southampton, UK). The VGF primer sequences were as follows: forward 5′‐TGAGACTTTGACACCCTTATCC and reverse 5′‐GGAACCGCCCAGGAATGA. Run conditions were as follows: 50 °C for 2 min, 95 °C for 15 min followed by 40 cycles of 95 °C for 15 sec, 60 °C for 30 sec, and 72 °C for 1 min. Data are presented as fold change relative to control after normalization to the mean of housekeeping genes B2M and RPL13 (PrimerDesign proprietary primer sequences).

To determine whether a strain belonging to the SAR116 group can produce DMS from DMSP, the IMCC1322 strain, which is one of two isolates belonging to SAR116 [35 (link)], was grown in the R2A broth. When the strain grew to an OD₆₂₀ of 0.03, the culture was dispensed in two 30-ml sterile vials. Then, the DMSP substrate (final conc. of 500 μM) was injected into one of the vials, and DMS concentrations in the medium were quantified using DMS extraction, a trapping device, and a gas chromatograph equipped with a flame photometric detector (GF-FPD; [36 ]). Following the addition of DMSP, 50–100 μl of the samples was removed using a 250-μl gastight syringe (Hamilton 1725RN; Sigma-Aldrich, St. Louis, MO, USA). Sequential DMS measurements were carried out over periods of 15 min to 8 h. Abiotic control, containing the same concentration of DMSP substrate and filtered seawater, was prepared in parallel to correct for any background sources of DMS [37 ].
Reverse transcription (RT)-PCR was performed to examine expression of the dddP gene in IMCC1322 in the absence and presence of the DMSP substrate. Total RNA was extracted using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions. cDNA was prepared from the RNA using the QuantiTech Reverse Transcription Kit (Qiagen). Subsequent PCR was conducted using the primer sets targeting 16S rRNA and dddP genes (S1 Table).

Total RNA was extracted and purified using RNeasy Mini Kit (Qiagen, Hilden, Germany) following the manufacturer′s instruction. Reverse-transcription reaction was performed using QuantiTech Reverse Transcription Kit (Qiagen) to prepare cDNA samples. The quantitative real-time PCR (qRT-PCR) was conducted by QuantiTect SYBR Green PCR Kit (Qiagen) with 1 µM primers for CCND1 (right: 5′-GACCTCCTCCTCGCACTTCT-3′; left: 5′-GAAGATCGTCGCCACCTG-3′; Invitrogen, USA) on LightCycler 480 real-time PCR system (Roche, Basel, Switzerland). The expression of GAPDH was used as endogenous control (right: 5′-GCCCAATACGACCAAATCC-3′; left: 5′-GCTAGGGACGGCCTGAAG-3′ Invitrogen, USA) for the normalization of gene expression of CCND1.

Five mice per group were immunized with 60 μg ova488, 30 μg αCD40, and 30 μg poly(I:C). About 12–14 days later, mice were killed and draining LNs were digested as described above. Cells were stained with CD45-PE. Cells then underwent negative selection using anti-PE microbeads and LS columns from Milltenyi and sorted on a BD FACsAria II cell sorter (BD Biosciences, San Jose, CA) based on the lack of CD45, PDPN+, CD31+, and fluorescent antigen (Supplementary Fig. 1, bottom). Antigen-positive and antigen-negative cells were run through a QIAshredder (catalog number 79656, Qiagen, Hilden, Germany) before RNA was isolated using an RNA micro kit (catalog number 74004, Qiagen, Hilden, Germany). Complimentary DNA (cDNA) was made using the Qiagen Quantitech Reverse Transcription kit (catalog number 205314, Qiagen, Hilden, Germany). Taqman Primers to CCL20 (Assay ID number Mm01268754_m1) and the control gene, GusB (Assay ID number Mm01197698_m1), were purchased from Thermo Fisher (Waltham, MA) and run on a Thermo Fisher Step 1 plus real-time PCR machine. cDNA was quantified using the delta-delta CT method to establish the fold increase in CCL20 from antigen + LECs compared to antigen-LECs. Experiments were completed three times and five mice per group were pooled for qRT-PCR. An unpaired t-test was used to determine statistical significance.

RNA was prepared using Trizol (Life Technologies) and cDNA prepared using Quantitech Reverse Transcription Kit (QIAGEN), both as per manufacturer’s instructions, using 5, 10, and 20 ng RNA templates to ensure the reaction was quantitative. qPCR was conducted using SyBr green (Quanta) and the Bio-Rad CFX platform, with a 60°C annealing temperature and the primer pairs that are tabulated in the Supplemental Experimental Procedures.

Total RNA was isolated from whole embryos as described by Lee-Liu et al. (2012) (link). cDNA was synthesized using the QuantiTech Reverse Transcription Kit (Qiagen).