ESCs were grown in feeder-free conditions using either DMEM-based medium with 15% FBS and 1000 U/ml ESGRO LIF (Millipore) or in 2i culturing conditions using DMEM F-12 (Gibco 21331) and neurobasal media (Gibco 21102) supplemented with N2 (Life tech. 17502048), B27 (Gibco 17504-044), 1000 U/ml ESGRO LIF (Millipore), Mek inhibitor (PD0325901) and GSK3b inhibitor (CHIR99021). For shRNA-mediated gene knockdown, ESCs were infected with viral particles carrying pLKO.1 constructs harbouring gene-specific shRNAs from The RNAi Consortium (shSETDB1, CCCGAGGCTTTGCTCTTAAAT, TRCN0000092975; shTET1, TTTCAACTCCGACGTAAATAT, TRCN0000341848; shTET2, TTCGGAGGAGAAGGGTCATAA, TRCN0000250894) or a non-targeting sequence (shScr, CCTAAGGTTAAGTCGCCCTCGCTC). After 48 h, cells were selected with 1 μg/ml puromycin or 50 μg/ml hygromycin for 3 days.
Esgro lif
Manufactured by Merck Group
Sourced in United States, Germany
ESGRO LIF is a recombinant protein produced by the Merck Group. It is a cell culture supplement that supports the maintenance of embryonic stem cell (ESC) and induced pluripotent stem cell (iPSC) cultures in an undifferentiated state.
Automatically generated - may contain errors
Lab products found in correlation
Non essential amino acids (neaa), by Thermo Fisher Scientific (24 mentions)
Penicillin streptomycin, by Thermo Fisher Scientific (23 mentions)
Knockout dmem, by Thermo Fisher Scientific (17 mentions)
Glutamax, by Thermo Fisher Scientific (15 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (13 mentions)
2 mercaptoethanol, by Merck Group (12 mentions)
L glutamine, by Thermo Fisher Scientific (11 mentions)
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (11 mentions)
Sodium pyruvate, by Thermo Fisher Scientific (9 mentions)
Penicillin streptomycin glutamine (psg), by Thermo Fisher Scientific (7 mentions)
β mercaptoethanol, by Thermo Fisher Scientific (7 mentions)
Neurobasal medium, by Thermo Fisher Scientific (6 mentions)
Dmem f12, by Thermo Fisher Scientific (6 mentions)
Streptomycin, by Thermo Fisher Scientific (6 mentions)
Penicillin, by Thermo Fisher Scientific (5 mentions)
2 mercaptoethanol, by Thermo Fisher Scientific (5 mentions)
β mercaptoethanol, by Merck Group (5 mentions)
Mitomycin c, by Merck Group (3 mentions)
Mem non essential amino acid, by Thermo Fisher Scientific (3 mentions)
High glucose dmem, by Thermo Fisher Scientific (3 mentions)
69 protocols using esgro lif
1
Feeder-free Embryonic Stem Cell Maintenance
2
Murine Embryonic Stem Cell Culture and Editing
3
Murine Embryonic Stem Cell Culture and Editing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
During routine passage and CRISPR editing, murine ESCs were cultured in Serum+LIF media: 15% Hyclone FBS (ThermoFisher), 1x Penicillin/Streptomycin/Glutamine (ThermoFisher), 1x Non-essential amino acids (ThermoFisher), 55μM β–mercaptoethanol (ThermoFisher), 1xPrimocin (Invivogen) and 1000U/mL ESGRO LIF (Millipore) in KnockOut DMEM (ThermoFisher). Cells were passaged with 0.25% Trypsin every three days and cultured on MEFs. Prior to all RNA-seq or ATAC-seq experiments, cells were cultured for at least five passages in 2i+LIF media: 1x N2 supplement, 1xB27 supplement, 1x Penicillin/Streptomycin/Glutamine (ThermoFisher), 1x Non-essential amino acids (ThermoFisher), 55μM β–mercaptoethanol (ThermoFisher), 1xPrimocin (Invivogen), 3μM CHIR99021 (Stemgent), 0.5μM PD0325901 (Stemgent) and 1000U/mL ESGRO LIF (Millipore) in a 50%/50% mixture of DMEM/F12 without HEPES (ThermoFisher) and Neurobasal media (ThermoFisher). Cells passaged in 2i+LIF were passaged every three days with 0.25% trypsin and plated at 50k cells/well onto wells pretreated with poly-L-Ornithine (Sigma) and Laminin.
Murine EpiSCs were a gift from P. Tesar and were cultured in Primed hESC media12 (link). EpiSCs were passaged with 1xCollagenase Type IV (Life Technologies) every three days.
Murine EpiSCs were a gift from P. Tesar and were cultured in Primed hESC media12 (link). EpiSCs were passaged with 1xCollagenase Type IV (Life Technologies) every three days.
4
Feeder-Independent Culture of Sox1-GFP ESCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In this study, Sox1-GFP mouse ESCs containing GFP transgene under the control of the Sox1 promoter were used [1 (link),19 (link)]. These ESCs were derived from the 129P2/Ola strain. They were incubated at 37 °C in a 5% CO2 atmosphere under feeder-independent conditions. Single cell passages were performed at 2–3-day intervals using trypsin-EDTA (Gibco) in a gelatin-coated dish. The medium used was serum-free N2B27 medium (DMEM/F12 medium (Gibco), neurobasal medium (Gibco) 1:1 mixture, N2 supplement (Gibco), B27 supplement (Gibco), 100× penicillin/streptomycin/glutamine (Gibco), leukemia inhibitory factor (LIF, ESGRO; Chemicon), 3 μM of GSK inhibitor (Sigma), and 1 μM of MEK inhibitor (Sigma)).
5
Robust 2i Culture of Mouse Embryonic Stem Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Male 129S1-SvImJ × CAST-EiJ hybrid 2-3 mESCs 47 , were grown on 0.2% gelatinized petri-dish in 2i media [125 ml DMEM-F12 (ThermoFisher Scientific, #11330-032), 125 ml Neurobasal Medium (ThermoFisher Scientific, #21103-049), 1.25 ml NDiff Neuro-2 Medium Supplement 200x (Millipore, #SCM012), 83.5 μl 7.5 % BSA Fraction V (ThermoFisher Scientific, #15260-037), 2.5 ml B-27 Supplement 50x minus vitamin A (ThermoFisher Scientific, #12587-010), 1 μl B β-mercaptoethanol, 25 μl PD0325901 (Stemgent, #04-0006), 75 μl CHIR99021 (Stemgent, #04-0004), 25 μl LIF ESGRO (107 units LIF/ml stock) (Chemicon, #ESG1106), 1 % penicillin-streptomycin (ThermoFisher Scientific, #15140-163), 1 % non-essential amino acids (ThermoFisher Scientific, #11140-076), and 1 % L-glutamine (ThermoFisher Scientific, #25030-164)]. Media was changed daily. Cells were grown at 37 °C at 5 % CO2 and passaged every 3-4 days with TrypLE (Thermo Fisher Scientific, #12604039).
6
Robust 2i Culture of Mouse Embryonic Stem Cells
7
Maintenance of Mouse Embryonic Stem Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The mouse ESC lines (karyotype: XY) were derived from a C57BL/6 strain mouse and from
GFP-expressed transgenic mice [C57BL/6-Tg (CAG-EGFP), Japan SLC, Shuzuoka, Japan] and were
cultured on irradiated mouse embryonic fibroblasts (MEFs; CF1 strain, Jackson Laboratory,
Los GoTos, CA) as feeder cells. The mouse ESCs were maintained with ES cell culture medium
consisting of 80% (v/v) DMEM high glucose (HyClone, Logan, UT) containing 20% (v/v), SR
(Gibco-BRL, Frankin Lakes, NJ), 1% (v/v) NEAA (Gibco-BRL), 0.1% (v/v) β-mercaptoethanol
(Gibco-BRL), 100 U/ml LIF (ESGRO, Chemicon, Temecula, CA) at 37°C in a 5% humidified
CO2 incubator. For passaging, the mouse ESCs were detached from the dish by
treatment with 0.05% trypsin-EDTA (TE; HyClone) for 3 min and were split onto a new
MEF-seeded dish every 3–4 days. The mESC growth medium was changed daily.
GFP-expressed transgenic mice [C57BL/6-Tg (CAG-EGFP), Japan SLC, Shuzuoka, Japan] and were
cultured on irradiated mouse embryonic fibroblasts (MEFs; CF1 strain, Jackson Laboratory,
Los GoTos, CA) as feeder cells. The mouse ESCs were maintained with ES cell culture medium
consisting of 80% (v/v) DMEM high glucose (HyClone, Logan, UT) containing 20% (v/v), SR
(Gibco-BRL, Frankin Lakes, NJ), 1% (v/v) NEAA (Gibco-BRL), 0.1% (v/v) β-mercaptoethanol
(Gibco-BRL), 100 U/ml LIF (ESGRO, Chemicon, Temecula, CA) at 37°C in a 5% humidified
CO2 incubator. For passaging, the mouse ESCs were detached from the dish by
treatment with 0.05% trypsin-EDTA (TE; HyClone) for 3 min and were split onto a new
MEF-seeded dish every 3–4 days. The mESC growth medium was changed daily.
8
Culturing Mammalian Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HEK293T and NIH3T3 cells were cultured in DMEM with GlutaMAX supplemented with 10% of fetal bovine serum (FBS) and 1% of Penicillin-Streptomycin (P/S) (Gibco). Neuro-2a (N2A) (ACC 148, German Collection of Microorganisms and Cell Cultures) cells media was further supplemented with non-essential aminoacids (NEAA). Mouse embryonic stem cells (mESCs) v6.4 were cultured in DMEM GlutaMax supplemented with 1% Sodium Pyruvate (Invitrogen), 15% FBS, 50 mM ß-mercaptoethanol, 1% NEAA (Invitrogen), 1% P/S and 1000 U/ml LIF (ESGRO, Chemicon).
9
Generation and Maintenance of ESC Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CTL (F18) and H1-KO (F6) ESC lines were previously generated by Fan et. al., [12] (link), [14] (link). The number of ESC passages was kept at 8 passages or less and karyotypic profiles were analyzed prior to experimental manipulations. ESCs were maintained in an undifferentiated state on 0.1% gelatin-coated tissue culture plates in ES cell media consisting of knockout Dulbecco's minimal essential medium (Invitrogen, DMEM, 10313), 10% ES-qualified FBS (ATCC, SCRR-30-2020), 1X MEM nonessential amino acids (from 100× stock, Invitrogen 11140), 1X L-glutamine and antibiotics (from 100× stock, Invitrogen 10378-016), 0.1 mM 2-mercaptoethanol (Sigma, M7522), supplemented with 1000 U/ml of leukemia inhibitory factor (LIF/ESGRO; Chemicon, ESG1106). Media was changed daily and cell density was kept below 70% confluency.
10
Mouse Embryonic Stem Cell Culture
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The mouse ESC line R1 was cultured on mouse primary embryonic fibroblast feeder cells that were treated with mitomycin C (Sigma, St. Louis, MO, USA) and grown in Dulbecco’s modified Eagle’s medium (DMEM) (Gibco, Carlsbad, CA, USA) supplemented with 15% fetal calf serum (Hyclone, Logan, UT, USA), 1% non-essential amino acids, 1% penicillin/streptomycin, 0.1 mM 2-mercaptoethanol, 1,000 U/mL LIF (ES-GRO; Chemicon, Temecula, CA, USA), 2 mM L-glutamine and 1 mM MEM sodium pyruvate solution (Gibco, USA) at 37°C under 5% CO2. Human embryonic kidney (HEK) 293T cells (ATCC: CRL 11268; Manasas, VA, USA) were maintained in DMEM (Gibco, USA) supplemented with 10% fetal calf serum (Hyclone, USA), 100 U/mL penicillin and 100 μg/mL streptomycin (Gibco, USA) at 37°C under 5% CO2.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!