For recombinant expression of the A. fumigatus allergen Aspf4, the respective sequence (Afu2g03830, obtained from the Aspergillus Genome Database, http://aspgd.org/ , accessed on 13 June 2019) was amplified from cDNA derived from A. fumigatus strain AfS35. PCR amplification was performed using Q5 High-fidelity DNA polymerase (New England Biolabs, Frankfurt am Main, Germany). The following oligonucleotide sequences were used: GCAGGATCC CACGAGCGCCGCCACCTCCAC (forward, BamHI restriction site underlined) and GCAAAGCTT CTACTCCTTGTAGTCGAGGTT (reverse, HindIII restriction site underlined). The PCR amplicons were cloned into the expression vector pQE30 (Qiagen, Hilden, Germany) using the primer-derived restriction sites. After transformation into E. coli strain M15 pREP4 (Qiagen, Hilden, Germany), the recombinant proteins were purified using HisTalon gravity columns (Takara-Bio Inc., Kusatsu, Präfektur Shiga, Japan) according to the vendor’s instructions.
M15prep4
Manufactured by Qiagen
Sourced in Germany
The M15pREP4 is a plasmid-based expression system for producing recombinant proteins in E. coli. It features the lac promoter for inducible expression and the pUC origin of replication for high-copy number. The system is designed for simple cloning and high-level protein production.
Automatically generated - may contain errors
Lab products found in correlation
Neb5α, by New England Biolabs (2 mentions)
Bl21 de3 plys, by Thermo Fisher Scientific (2 mentions)
Bl21 de3 plyss, by AMS Biotechnology (2 mentions)
Nanodrop 2000c, by Thermo Fisher Scientific (2 mentions)
Pqe30, by Qiagen (1 mentions)
Histalon gravity column, by Takara Bio (1 mentions)
Q5 high fidelity dna polymerase, by New England Biolabs (1 mentions)
Protoblue safe, by National Diagnostics (1 mentions)
Top10, by Thermo Fisher Scientific (1 mentions)
Ni2 nitrilotriacetic acid agarose beads, by Qiagen (1 mentions)
Las 3000 imaging system, by Fujifilm (1 mentions)
Histrap 5 ml column, by GE Healthcare (1 mentions)
Protease inhibitor cocktail, by Nacalai Tesque (1 mentions)
Xtractor buffer, by Takara Bio (1 mentions)
Talon metal affinity resin, by Takara Bio (1 mentions)
Dnase 1, by Roche (1 mentions)
Pqe40, by Qiagen (1 mentions)
Pgex 2tk vector, by GE Healthcare (1 mentions)
Glutathione sepharose 4b, by GE Healthcare (1 mentions)
Ni nta agarose, by Qiagen (1 mentions)
19 protocols using m15prep4
1
Recombinant Expression of Aspf4 Allergen
2
Purification and Assay of His6-PA1198
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CtpA and LbcA were purified as described above. To purify His6-PA1198, E. coli strain M15 (pREP4) (Qiagen) containing pAJD2948 was grown in 500 mL of LB broth at 37°C to an OD600 of 0.6 to 1.0. Protein production was induced with 1 mM IPTG at 37°C for 3 h. His6-PA1198 was purified natively by Ni-NTA-agarose affinity chromatography in 50 mM NaH2PO4 and 300 mM NaCl, as recommended by the manufacturer (Qiagen). Protein was eluted in 50 mM NaH2PO4, 300 mM NaCl, 50 mM imidazole, pH 8. Assays were done as described previously (23 (link), 36 (link)). The samples were separated by SDS-PAGE and stained with ProtoBlue Safe (National Diagnostics). For mutant CtpA protein experiments, ImageJ analysis was used to determine the densities of the His6-PA1198 bands. His6-PA1198 degradation was quantified by comparing His6-PA1198 band density to that in the reaction with inactive CtpA-S302A. Averages from two independent experiments are reported.
3
E. faecalis V19 Strain Cultivation and Genetic Manipulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The reference strain used in this study is E. faecalis V19, which corresponds to a plasmid-cured strain derived from the V583 strain of clinical origin (Paulsen et al., 2003 (link)). Overnight cultures were achieved in M17 medium supplemented with 0.5% glucose (GM17). Escherichia coli strains TOP10 (ThermoFisher, Waltham, MA, United States), NEB-5α (New England BioLabs, Ipswich, MA, United States), and M15 pRep4 (Qiagen, Hilden, Germany) were used for RNA in vitro production, mutant constructions, and recombinant protein synthesis, respectively. Media were supplemented with chloramphenicol (Cm 10 μg/ml), kanamycin (Kan 50 μg/ml), or ampicillin (Amp 100 μg/ml) when needed (Supplementary Table 1 ).
4
Bacterial Strain Manipulation and DNA Damage Response
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Escherichia coli strain DH5α was routinely used for plasmid constructions destined to be transformed into B. thuringiensis. Strain XL10-Gold (Stratagene) was used for site-directed mutagenesis, and strains M15 [pREP4] (Qiagen) and BL21 (DE3) pLysE were used for protein expression, as described.
Bacillus thuringiensis serovar israelensis isogenic strains GBJ002 and GBJ338 were used as GIL01-cured and GIL01-lysogenic hosts, respectively (17 (link)). B. thuringiensis strains GBJ396 [lexA(A96D)] and GBJ499 [recA::pMutin4] are GBJ002 derivatives mutated in the lexA and recA genes, respectively (17 (link)).
Escherichia coli and B. thuringiensis strains were grown in L-broth at 37°C and 30°C, respectively. To induce DNA damage, mitomycin C (0.05 μg/ml) was added to one-half of mid-log phase cultures for 1 h at 30°C. To induce gp7 expression in Bacillus, 0.1 mM isopropyl β-d -thiogalactopyranoside (IPTG) was added to one-half of the cultures and the other half was incubated in parallel to provide an uninduced control. After 1 h of induction, cultures were stressed by addition of mitomycin C (0.05 μg/ml) for an additional hour.
Bacillus thuringiensis serovar israelensis isogenic strains GBJ002 and GBJ338 were used as GIL01-cured and GIL01-lysogenic hosts, respectively (17 (link)). B. thuringiensis strains GBJ396 [lexA(A96D)] and GBJ499 [recA::pMutin4] are GBJ002 derivatives mutated in the lexA and recA genes, respectively (17 (link)).
Escherichia coli and B. thuringiensis strains were grown in L-broth at 37°C and 30°C, respectively. To induce DNA damage, mitomycin C (0.05 μg/ml) was added to one-half of mid-log phase cultures for 1 h at 30°C. To induce gp7 expression in Bacillus, 0.1 mM isopropyl β-
5
Recombinant Expression and Purification of Botulinum Neurotoxin Fragments
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Example 6
(1) Plasmid Constructions:
The gene portions encoding native BH (SEQ ID NO: 1) and its propeptide (SEQ ID NO: 2) were amplified by PCR using suitable oligonucleotides and genomic DNA of C. botulinum ATCC 3502, fused to an oligonucleotide coding for the His6Tag and inserted into pQE3 (Qiagen) yielding the expression plasmid pQ-BH1445H6-249-581 and pQ-BH1445H6-1-581, respectively. Nucleotide sequences were verified by DNA sequencing.
(2) Purification of Recombinant Proteins:
nBH and iBH, fused to a carboxyl-terminal His6Tag, were produced utilizing the E. coli strain M15pREP4 (Qiagen) during ten hours of incubation at room temperature, and were purified on Talon-sepharose beads (Clontech Inc.) following to the manufacturer's instructions. Fractions containing the desired proteins were pooled, frozen in liquid nitrogen, and kept at −70° C. iBH was isolated as recombinant protein with a MW of 63 kDa (
6
Plasmid Propagation and Protein Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
XL1-Blue strain (recA1 endA1 gyrA96 thi-1 hsdR17 supE44 relA1 lac F´ proAB lacIqZ∆M15 Tn10 Tetr) was used to propagate plasmids and express the aeBlue protein. We also tested protein expression in M15/pREP4 (Qiagen) and BL21 Rosetta (Novagen) without observing differences (data not shown).
7
Purification of E. coli Recombinant Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The E. coli strain M15pREP4 (Qiagen GmbH, Hilden, Germany) was used for the production of LCs, whereas the strain BL21-DE3 (Stratagene Europe, Ebsdorfergrund, Germany) was used for VAMP-2. E. coli cultures were induced for 15 h at 21 °C, and proteins were purified on Ni2+–nitrilotriacetic acid–agarose beads (Qiagen GmbH, Hilden, Germany) according to the manufacturer’s instructions. Fractions containing the desired proteins were dialyzed against toxin assay buffer (150 mM potassium glutamate, 10 mM HEPES-KOH, pH 7.2), frozen in liquid nitrogen, and kept at −70 °C. Protein concentrations were determined following SDS-PAGE analysis and Coomassie blue staining by means of the LAS-3000 imaging system and the AIDA 3.51 program (both Fuji Photo Film, Co., Ltd., Tokyo, Japan), using various known concentrations of bovine serum albumin as standards.
8
Production and Purification of EgTrp Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The EgTrp recombinant proteins were produced and purified as previously described [20 (link)]. Briefly, pQIA-EgTrp was expressed in the M15 (pREP4) (Qiagen) Escherichia coli strain. Bacterial cells containing the relevant plasmid were cultured at 37°C in yeast extract and tryptone medium supplemented with ampicillin/kanamycin, up to an OD600 nm of 0.5 to 0.7. EgTrp expression was induced by the addition of 1.5 mM isopropyl β-D-1-thiogalactopyranoside, and the bacteria were incubated for an additional 3h. The bacteria were then lysed in cell lysis buffer (50 mM phosphate buffer pH 8, 300 mM NaCl, 20 mM imidazole) and ruptured by sonication. Cellular debris were removed by centrifugation at 15 000 x g for 30 minutes at 4°C, and the supernatant was loaded onto a His-Trap 5 mL column (GE Healthcare). Elution was performed with a buffer containing increasing concentrations of imidazol (100 mM, 200 mM, 300 mM, and 500 mM). The fractions were analyzed by SDS-PAGE and MALDI-TOF mass spectrometry.
9
Recombinant Botulinum Neurotoxin A Purification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Example 6
(1) Plasmid Constructions:
The gene portions encoding native BH (SEQ ID NO: 1) and its propeptide (SEQ ID NO: 2) were amplified by PCR using suitable oligonucleotides and genomic DNA of C. botulinum ATCC 3502, fused to an oligonucleotide coding for the His6Tag and inserted into pQE3 (Qiagen) yielding the expression plasmid pQ-BH1445H6-249-581 and pQ-BH1445H6-1-581, respectively. Nucleotide sequences were verified by DNA sequencing.
(2) Purification of Recombinant Proteins:
nBH and iBH, fused to a carboxyl-terminal His6Tag, were produced utilizing the E. coli strain M15pREP4 (Qiagen) during ten hours of incubation at room temperature, and were purified on Talon-sepharose beads (Clontech Inc.) following to the manufacturer's instructions. Fractions containing the desired proteins were pooled, frozen in liquid nitrogen, and kept at −70° C. iBH was isolated as recombinant protein with a MW of 63 kDa (
10
Recombinant Protein Expression and Antibacterial Evaluation
Check if the same lab product or an alternative is used in the 5 most similar protocols
Escherichia coli strain BL21 (DE3) pLysS (Invitrogen, Karlsruhe, Germany) and M15 (pREP4) (Qiagen, Hilden, Germany) were used for gene expression and cultivated at 37 °C in Terrific broth (TB) medium. The plasmids pVW90, pALF49, pPM37, pJW12, and pLW40 were used for overproduction of the proteins EchPT1, FgaPT2_R244L, FgaPT2_Y398F, 6-DMATSSa, and 7-DMATS, respectively (Fan and Li 2016 (link); Kremer et al. 2007 (link); Mai et al. 2016 (link); Winkelblech and Li 2014 (link); Wohlgemuth et al. 2017 (link)). To select the recombinant strains, ampicillin (50 μg/mL) and kanamycin (25 μg/mL) were added to the medium.
Escherichia coli ATCC 35218, Enterococcus faecalis DSM2570, Klebsiella pneumoniae DSM26371, Bacillus subtilis NCIB 3610, Bacillus circulans NRRL B-380, Staphylococcus aureus ATCC 29213, Staphylococcus delphini DSM20771, and Pseudomonas aeruginosa ATCC 27853 were used to evaluate the antibacterial activity.
+ Expand
Escherichia coli strain BL21 (DE3) pLysS (Invitrogen, Karlsruhe, Germany) and M15 (pREP4) (Qiagen, Hilden, Germany) were used for gene expression and cultivated at 37 °C in Terrific broth (TB) medium. The plasmids pVW90, pALF49, pPM37, pJW12, and pLW40 were used for overproduction of the proteins EchPT1, FgaPT2_R244L, FgaPT2_Y398F, 6-DMATSSa, and 7-DMATS, respectively (Fan and Li 2016 (link); Kremer et al. 2007 (link); Mai et al. 2016 (link); Winkelblech and Li 2014 (link); Wohlgemuth et al. 2017 (link)). To select the recombinant strains, ampicillin (50 μg/mL) and kanamycin (25 μg/mL) were added to the medium.
Escherichia coli ATCC 35218, Enterococcus faecalis DSM2570, Klebsiella pneumoniae DSM26371, Bacillus subtilis NCIB 3610, Bacillus circulans NRRL B-380, Staphylococcus aureus ATCC 29213, Staphylococcus delphini DSM20771, and Pseudomonas aeruginosa ATCC 27853 were used to evaluate the antibacterial activity.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!