Sybr green qpcr assay

Total RNA was extracted from cultured cells using Trizol reagent (Invitrogen). The expression of mRNA was measured using a SYBR Green qPCR assay (Takara). The expression of GAPDH served as an endogenous control. The 2^−ΔCT method was applied for data processing.

Total RNA was extracted from cultured cells using TRIzol reagent (Invitrogen). The miRNA and mRNA levels were measured using a SYBR Green qPCR assay (TaKaRa, Dalian, China) following the methods described before^{34 (link)}. The expression of GAPDH (reference for mRNA determination) or RNU6B (reference for miRNA determination) served as an endogenous control. The sequences of the PCR primers are presented in Supplementary Table S1. The 2^−ΔCT method was applied for data processing.

Total RNA was extracted from cells using Trizol reagent (Invitrogen, CA, USA) and detected mature miR-101 expressions in cells using a Hairpin-it TM miRNAs qPCR kit (Genepharma, Shanghai, China). Primers for miR-101 were forward, 5’-GGCGTACAGTACTGTGATA-3’. Expression of RNU6B was used as an endogenous control. Primers for RNU6B were forward, 5’-CTCGCTTCGGCAGCACA-3’ and reverse, 5’-AACGCTTCACGAATTTGCGT-3’. MALAT1 expression was measured by SYBR green qPCR assay (Takara, Dalian, China). Primers for MALAT1 were forward, 5’- AAGAAGCCGAAATAAATGAG-3’ and reverse, 5’-AGCCCACAGGAACAAGTC- 3’. Data were processed using 2^-ΔΔCT method.

Total RNA was extracted from cells using Trizol reagent (Invitrogen, Carlsbad, CA, United States). Total RNA was reverse transcribed using a transcription kit (Invitrogen) to get total cDNA as templates for MIAT detection, or transcribed with Takara^TM microRNA transcription kit to get cDNA as templates for miR-34a detection. The expression of MIAT was measured by SYBR green qPCR assay (Takara, Dalian, China) according to manufacturers’ instructions. Expression of β-actin was used as an endogenous control. MiR-34a expression was detected using a Hairpin-it TM miRNAs qPCR kit (Genepharma, Shanghai, China) according to manufacturers’ instructions. Expression of RNU6B was used as an endogenous control. QPCR was performed at the condition: 95.0°C for 3 min, and 39 circles of 95.0°C for 10 s and 60°C for 30 s. Data were processed using 2^-ΔΔCT method. The primers were used as following: 5′- TCCCATTCCCGGAAGCTAGA -3′(forward), 5′- GAGGCATGAAATCACCCCCA -3′(reverse) for MIAT. 5′- TTGTTACAGGAAGTCCCTTGCC-3′(forward), 5′- ATGCTATCACCTCCCCTGTGTG-3′(reverse) for β-actin. Sequence of miRNA and references using in current study are: miR-34a: UGGCAGUGUCUUAGCUGGUUGU; RNU6B: CGCAAGGAUGACACGCAAAUUCGUGAAGCGUUCCAUAUUUUU. The reverse primers were also used in the Hairpin-it TM miRNAs qPCR kit.

Total RNA was extracted from tissues or cells using Trizol reagent (Invitrogen, CA, USA). BANCR expressions were measured by SYBR green qPCR assay (Takara, Dalian, China) in triplicate. Primer sequences were as follows: BANCR, forward: ACAGGACTCCATGGCAAACG, reverse: ATGAAGAAAGCCTGGTGCAGT; GAPDH, forward: ACCACAGTCCATGCCATCAC, reverse: TCCACCACCCTGTTGCTGTA. Data were processed using 2-^ΔΔCT method and normalized to GAPDH expression.

Total RNA from clinical tissues and stably transfected HTR-8/Svneo and BeWo cells was isolated using Trizol (Invitrogen, USA). ImProm-II Reverse Transcription System (Promega, USA) was then used to generate first-strand cDNA. SYBR Green qPCR assay (Takara, Dalian, China) and gene-specific primers were used for qRT-PCR with GAPDH or U6 used for normalization following the manufacturer’s protocol. The relative expression levels of genes were calculated according to the 2^−ΔΔCt method [16 (link)]. Each sample was tested in triplicates for statistical analysis.