Bioruptor plus device

Isolates selected for WGS were confirmed by sequencing the internal transcribed spacer (ITS) using the ITS5 (5’ GGAAGTAAAAGTCGTAACAAGG 3’) and ITS4 (5’ TCCTCCGCTTATTGATATGC 3’) primers as previously described [39 ]. High-quality genomic DNA was sheared with a Bioruptor Plus device (Diagenode, Inc.). Briefly, genomic DNA was diluted to 10 ng/μl with TE (10 mM Tris, 1mM EDTA, pH 7.5–8.0 buffer) and 100 μl was transferred to 0.5 ml Bioruptor microtubes (Diagenode, Inc.). The samples were incubated on ice for 15 minutes and sheared with the following setting: on/off-30/90 sec for 30 cycles. The fragmented DNA was visualized on a 2% gel and 200–300 bp fragments excised and cleaned using a PureLink Quick Gel Extraction Kit (Thermo Fisher Scientific Inc.). Illumina libraries were prepared using a PCR-free KAPA Hyper Prep Kit followed by qPCR library quantitation using the KAPA Library Quantification Kit (Kapa Biosystems) and sequenced on an Illumina device. Raw sequences were deposited in National Center for Biotechnology Information (NCBI) database as BioProject (PRJNA382361).

Chromatin immunoprecipitation (ChIP)‐qPCR was performed following the previously published protocol with slight modification.¹⁸ Briefly, hMyotubes were collected and washed in PBS, then cross‐linked with 1% (vol/vol) formaldehyde diluted in PBS for 12 min. Next, to stop the cross‐linking reaction, cells were incubated in 0.125 M Glycine for 5 min at RT. After washes with PBS, cells were lysed in lysis buffer (50 mM Tris–HCl, 10 mM EDTA, 1% SDS and pH 8.0) for 5 min. The mixture was sonicated by a Bioruptor® Plus device (Diagenode), and supernatants were incubated overnight at 4°C with Protein A/G Dynabeads (Thermo Fisher Scientific) conjugated with 2.4 μg anti‐FOXO3 antibody or rabbit IgG. Subsequently, immunoprecipitated chromatin eluting and decross‐linking were performed at 68°C for 3 h on a thermomixer. DNA was then collected by the phenol‐chloroform‐isoamylalcohol extraction and ethanol precipitation method, after which purified DNA was subjected to qPCR for evaluation of FOXO3 occupation at the promoter of SESN1 gene. The primers used for ChIP‐qPCR are listed in Table S4. The antibodies used in this study are listed in Table S3.

For the ChIP assays, pear calli were transformed with the recombinant PpERF9-MYC construct or the empty construct (MYC alone). Regarding the histone deacetylation analysis, PpERF9-OX and PpTPL1-OX (pCAMBIA1301) pear calli were used. The ChIP assays were performed as previously described, with some modifications (Han et al. 2016 (link)). For the cross-linking step, pear calli or fruit peels were treated with 1% formaldehyde (v/v) for 10 min. Next, the chromatin was extracted via sucrose gradient centrifugation. The chromatin DNA was sonicated for 30 min at 0°C (30 s with 30 s intervals) using the Bioruptor Plus device (Diagenode) to generate 200- to 500-bp fragments. The chromatin DNA fragments were incubated overnight with Anti-MYC (Sigma-Aldrich, 05-724) or anti-H3ac antibodies (Millipore, Catlog # 06-599/Lot # 2842168), after which the amount of immunoprecipitated chromatin was determined by qPCR. Each ChIP assay was repeated 3 times, and the enriched DNA fragments in each ChIP sample were used as 1 biological replicate for the qPCR analysis. The PpACTIN gene was used as the internal control for normalizing the ChIP enrichment signal in pear calli and fruit peels. The primers used for the ChIP-qPCR analysis are listed in Supplemental Table S2.