D 001206 13

Open reading frame of human ACTN1 or GFP in pENTR223 entry vector were transferred into the pcDNA6.2/N-EmGFP-DEST destination vector (Invitrogen) to generate GFP-tagged α-actinin-1 and GFP control at Genome Biology Unit core facility (University of Helsinki). Human CDH1-pcDNA3 plasmid was obtained from Addgene [71 (link)]. To generate stable EpH4, NMuMG or MDA-MB-231 cells expressing GFP (control) or GFP-tagged α-actinin-1 (α-actinin-1) or GFP-tagged E-cadherin (+ E-cadherin) cells were transfected using Lipofectamine2000 according to provided protocol, and cultured under blasticidin (15205, Sigma-Aldrich) or geneticin (G418, 10131019, Invitrogen) selection.
For siRNA mediated downregulation of ACTN1 or ACTN4 mix of two oligos were used for each gene: ACTN1; J-011195-05, J-011195-06 and ACTN4; J-011988-08, J-011988-09 (Dharmacon). For control non-targeting siRNA oligo was D-001206-13 (Dharmacon). To improve downregulation efficiency Lipofectamine2000 (Invitrogen) mediated transfection was conducted on two consecutive days following the a day after seeding, and samples for western blotting and immunofluorescence analyses were collected 72–82 hours after the first transfection.

MUTZ-LCs were transfected with 50 nM siRNA with the transfection reagent DF1 (Dharmacon) and were used for experiments 72 h after transfection. The siRNA was specific for Caveolin-1 (M-003467-01; SMARTpool; Dharmacon) and nontargeting siRNA (D-001206-13; Dharmacon) served as control. Silencing of caveolin-1 expression was verified by real-time PCR (Supplementary Figure 2b). Primer sequences were as follows: caveolin-1 forward, 5’-TTTACCGCTTGCTGTCTGCC-3’; caveolin-1 reverse, 5’- GGTACAACTGCCCAGATGTGC -3’; β-actin forward, 5’-GCTCCTCCTGAGCGCAAG-3’ β-actin reverse, 5’- CATCTGCTGGAAGGTGGACA-3’.

Cells were seeded in 6-well/plates (150,000 cells/well) and grown up to 30 % confluence. After 24 h, cells were transfected with ON-TARGETplus SMART pool siRNA against EZH2 (L-004218-00) or non-targeting siRNA (control; D-001206-13) (both from Dharmacon, Thermo Fisher Scientific, Lafayette, CO, USA) or with a siRNA targeting the 5′-UTR of EZH2 mRNA with the following sequence 5′-CGGTGGGACTCAGAAGGCA-3′ and non-targeting siRNA as control (5′-UGGUUUACAUGUCGACUAA-3′) (both from Sigma, St Louis, MO, USA) [32 ] at 100 nM final concentration each round using Oligofectamine (Invitrogen, Carlsbad, CA), according to manufacturer’s recommendations. After 24 h, cells were transfected again and siRNA effectiveness was validated by Western blotting and RT-qPCR 48 h after the first silencing. For pharmacological treatments, cells were treated with either 5 μM deazaneplanocin A (DZNep) or water as vehicle for 48 h or 72 h.

OA synovial fibroblasts were seeded overnight in 48-well plates at a concentration of 40,000 cells per well. Cells were cultured in RPMI-1640 (Sigma-Aldrich, R8758) in 1% FCS (Sigma-Aldrich, F7524), sodium orthopyruvate (1%) (Sigma-Aldrich, S8636), non-essential amino acids (1%) (Sigma-Aldrich, M7145). Cells were then transfected with either a non-targeting control (NTC) siRNA (Dharmacon, D-001206-13) or a GLS1 siRNA (Dharmacon, MQ-004548-01-0005) at concentrations of either 5 nM or 100 nM. Following 24 h, the supernatants were collected for cytokine analysis by enzyme-linked immunosorbent assay (ELISA) (IL-6 DuoSet kit, R&D Systems, DY206), and cells were lysed with TRIzol reagent (Life technologies, Paisley, UK, 15596026) for RNA extraction.

A rat monoclonal antibody against the hemagglutinin (HA) epitope tag (11 867 423 001), a mouse monoclonal antibody against the Myc epitope tag (05–724), and rabbit polyclonal antibody against the V5 epitope tag (V8137) were purchased from Roche Applied Science (Germany), Merck Millipore (MA, USA), and SIGMA-Aldrich (MO, USA), respectively. A goat polyclonal antibody against Akt2 (AF23151) was purchased from R&D systems (MN, USA). Mouse monoclonal antibodies against Rac1 (610650) and RalA (610221) were purchased from BD Biosciences (CA, USA). A mouse monoclonal antibody against α-tubulin (T9026) was purchased from SIGMA-Aldrich. Antibodies against goat IgG, mouse IgG, rabbit IgG, and rat IgG conjugated with CF 350/543/647 were purchased from Biotium (CA, USA). A sheep polyclonal antibody against mouse IgG conjugated with horseradish peroxidase (NA9310) was purchased from GE Healthcare (UK). Insulin was purchased from Eli Lilly (IN, USA). Two siRNA duplexes against mouse Akt2, #1 (Genosys (MO, USA), Mm_AKT2_4936; 5´-GAGAUGUGGUGUACCGUG-3´) and #2 (Genosys, Mm_AKT2_4937; 5´-GACUCUUCCACAUCUGAG-3´), and a mixture of non-targeting control (NC) siRNA duplexes (Dharmacon (CO, USA), D-001206-13; Duplex 1, 5´-AUGAACGUGAAUUGCUCAAUU-3´; Duplex 2, 5´-UAAGGCUAUGAAGAGAUACUU-3´; Duplex 3, 5´-AUGUAUUGGCCUGUAUUAGUU-3´; and Duplex 4, 5´-UAGCGACUAAACACAUCAAUU-3´) were commercially obtained.