Pspcas9 bb 2a puro px459

Manufactured by Addgene

Sourced in United States

PSpCas9(BB)-2A-Puro (PX459) is a plasmid that encodes for the Streptococcus pyogenes Cas9 (SpCas9) protein and a puromycin resistance gene. The Cas9 protein is a key component of the CRISPR-Cas9 system, which can be used for genome editing applications.

Automatically generated - may contain errors

Lab products found in correlation

70 protocols using pspcas9 bb 2a puro px459

Recombinant CRISPR-Cas Protein Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

The genes encoding the NmeCas9, SauCas9, CjeCas9, AcrIIC1, AcrIIC2 and AcrIIC3 were synthesized and codon-optimized for expression in E. coli. The genes encoding SpyCas9 and FnoCas9 were amplified from PX459 pSpCas9(BB)-2A-Puro (Addgene: #62988) and PX408 Francisella tularensis subsp. novicida Cas9 (Addgene: #68705), respectively, using standard PCR method. All constructs were inserted into modified pRSF-Duet-1 vector (Novagen) with the N-terminal His₆-SUMO tag followed by an ubiquitin-like protease (ULP1) cleavage site. In addition, NmeCas9, AcrIIC2, and AcrIIC3 were inserted into modified pET-28a vector (Novagen) with the N-terminal His₆-MBP tag; and AcrIIC3 was inserted into pGEX-6p-1 vector bearing the N-terminal GST tag. All point mutants, truncations and chimeras were prepared from the full-length constructs using PCR.

Zhu Y., Gao A., Zhan Q., Wang Y., Feng H., Liu S., Gao G., Serganov A, & Gao P. (2019). Diverse Mechanisms of CRISPR-Cas9 Inhibition by Type IIC Anti-CRISPR Proteins. Molecular cell, 74(2), 296-309.e7.

+ Open protocol

+ Expand

CRISPR-mediated Ccl2 and Ifngr2 Knockout

Check if the same lab product or an alternative is used in the 5 most similar protocols

Phosphorylated and annealed Ccl2-targeting [sgRNA (single guide RNA) 1 (3′-gRNA-5′): ACACGTGGATGTCTCCAGCCG and sgRNA 2 (5′-gRNA-3′): GCAAGATGATCCCAATGAGT] or Ifngr2-targeting sgRNAs (3′-gRNA-5′: AGGGAACCTCACTTCCAAGT) were cloned into target vector px458-pSpCas9(BB)-2A-GFP (Addgene no. 48138) or px459-pSpCas9(BB)-2A-Puro (Addgene no. 62988), respectively. 3LL ΔNRAS or KPAR^G12C cells were transfected using Lipofectamine (Thermo Fisher Scientific) with the px458 vector and fluorescence-activated cell sorting (FACS)–sorted for GFP expression or selected using puromycin treatment. Cells were then single cell–cloned before knockout screening via Sanger sequencing and protein analysis via enzyme-linked immunosorbent assay (ELISA) or FACS.

Mugarza E., van Maldegem F., Boumelha J., Moore C., Rana S., Llorian Sopena M., East P., Ambler R., Anastasiou P., Romero-Clavijo P., Valand K., Cole M., Molina-Arcas M, & Downward J. (2022). Therapeutic KRASG12C inhibition drives effective interferon-mediated antitumor immunity in immunogenic lung cancers. Science Advances, 8(29), eabm8780.

+ Open protocol

+ Expand

FBXW7 Knockout via Inducible Cas9

Check if the same lab product or an alternative is used in the 5 most similar protocols

The single-guide RNA (sgRNA)/Cas9 dual expression vector PX459 (pSpCas9(BB)-2A-Puro) was obtained from Addgene. The sequences for sgRNAs targeting FBXW7 were: sgFBXW7-1, AGTGGAAG-TATGCCCATATA; sgFBXW7-2, CAGCTCAGACATGTCGCTAC; sgFBXW7a, TGTGGTAACCGAATAGTTAG; sgFBXW7b, TTCG-GCGTCGTTGTTGCCCT; sgFBXW7g, TTCGGCGTCGTTGTTGC-CCT. To generate doxycycline-inducible FBXW7 knockout, TLCV2 plasmid backbone containing P2A-puromycin was used. All the above constructs were confirmed by Sanger sequencing.

Yang Z., Hu N., Wang W., Hu W., Zhou S., Shi J., Li M., Jing Z., Chen C., Zhang X., Yang R., Fu X, & Wang X. (2022). Loss of FBXW7 Correlates with Increased IDH1 Expression in Glioma and Enhances IDH1-Mutant Cancer Cell Sensitivity to Radiation. Cancer research, 82(3).

+ Open protocol

+ Expand

DYRK1A and DCAF7 Knockout Cell Line Generation

Check if the same lab product or an alternative is used in the 5 most similar protocols

The 293T-based DYRK1A or DCAF7 KO cell line was generated by using CRISPR–Cas9 with a single guide RNA (sgRNA) 5′- GCCAAACATAAGTGACCAAC-3′ that targets exon 1 of DYRK1A and 5′-GCCAAGCGAAAGCGCTTATC-3′ that targets exon 1 of DCAF7. The plasmid vector pSpCas9(BB)-2A-Puro (PX459), which expresses Cas9 and sgRNA, was from Addgene (Plasmid #48139). Two days after transfection, cells were challenged with 2 μg/ml puromycin. The drug-resistant cells were diluted and allowed to grow into single colonies, which were subsequently examined for the loss of DYRK1A or DCAF7 expression by Western-blotting. The positive KO clones were verified by Sanger sequencing of the genomic amplicons obtained with the TA cloning kit (Life Technologies).

Yu D., Cattoglio C., Xue Y, & Zhou Q. (2019). A complex between DYRK1A and DCAF7 phosphorylates the C-terminal domain of RNA polymerase II to promote myogenesis. Nucleic Acids Research, 47(9), 4462-4475.

+ Open protocol

+ Expand

CRISPR-mediated Cathepsin K Knockout

Check if the same lab product or an alternative is used in the 5 most similar protocols

Two small guide RNAs (sgRNAs) were designed to target human cathepsin K using the CRISPR designing tool [31 (link)]. The sequences are as follows: oligomer1 5′-CAC CGA AAT CTC TCG GCG TTT AAT T-3′ and oligomer2 5′-AAA CAA TTA AAC GCC GAG AGA TTT C-3’. The sgRNAs were cloned into the pSpCas9 (BB)-2A-Puro (PX459) (Addgene, Watertown, MA, USA), and transiently transfected into Caki cells using Lipofactor-pMAX (Aptabio, Yongin, Korea). After 48 h, transfected cells were selected by 0.5 μg/mL puromycin for 2–3 week. Single-cell clones were randomly isolated and screened for knockout efficiency of cathepsin K using western blotting.

Seo S.U., Woo S.M., Kim M.W., Lee H.S., Kim S.H., Kang S.C., Lee E.W., Min K.J, & Kwon T.K. (2019). Cathepsin K inhibition-induced mitochondrial ROS enhances sensitivity of cancer cells to anti-cancer drugs through USP27x-mediated Bim protein stabilization. Redox Biology, 30, 101422.

+ Open protocol

+ Expand

Generating Rex1-GFP Constructs for Rat ESCs

Check if the same lab product or an alternative is used in the 5 most similar protocols

For the Rex1‐GFP template, the 5′ arm and 3′ arm of homologous combination sites in rat Rex1 and T2A‐GFP‐PA were inserted into the pEASY‐Blunt Simple plasmid (Transgene, CB111‐02). For sgRNA vectors, sgRNAs were designed with the CRISPR design website (http://crispor.tefor.net/) and ligated into pSpCas9n (BB)‐2A‐GFP (PX461) (Addgene, 48140) or pSpCas9(BB)‐2A‐Puro (PX459) (Addgene, 48139). For piggyBac (PB)‐SA‐RFP vector construction, an SA fragment was inserted into a PB‐RFP vector,³⁵ which was a kind gift from Dr. Wei Li (Institute of Zoology, Chinese Academy of Sciences, China). For overexpression of Thop1, the CDS of Thop1 was inserted into a PB‐CAG‐T2A‐Puro vector (a modified PB dual promoter vector [SBI, cat. no. PB513B]) (Figure S6A). The PBase vector (SBI, PB210PA‐1) was purchased from a local agent. All primers used are listed in Table S1. To deliver vectors into rat ESCs, approximately 2 × 10⁶ cells were electroporated with 5 μg of plasmids using an electroporator (Thermo, NEON) at 1300 V for 10 ms with 3 pulses.

Xu M., Zhao Y., Zhang W., Geng M., Liu Q., Gao Q, & Shuai L. (2022). Genome‐scale screening in a rat haploid system identifies Thop1 as a modulator of pluripotency exit. Cell Proliferation, 55(4), e13209.

+ Open protocol

+ Expand

CRISPR-Cas9 Mediated UPP1 Knockdown

Check if the same lab product or an alternative is used in the 5 most similar protocols

The expression vector pspCas9(BB)-2A-Puro (PX459) used to generate the UPP1 CRISPR–Cas9 constructs was obtained from Addgene (Plasmid 48139). The plasmid was cut using the restriction enzyme BbsI followed by the insertion of human or mouse uridine phosphorylase 1 sgRNA sequences (Supplementary Table 4), as previously described^{46 (link)}. The human and mouse sequences were obtained from the Genome-Scale CRISPR Knock-Out (GeCKO) library. For transfection, the human or mouse PDA cells were seeded at 150,000 cells per well in a 6-well plate a day earlier. The cells were transfected with 1 μg of plasmid pSpCas9-UPP1 using Lipofectamine 3000 Reagent (Invitrogen, L3000001) according to manufacturer’s instruction. After 24 h, the selection of successfully transfected cells was commenced by culturing the cells with 0.3 mg ml⁻¹ puromycin in DMEM. The puromycin-containing medium was replaced every two days until selection was complete, as indicated by the death and detachment of all non-transfected cells. Thereafter, the successfully transfected cell lines were expanded and clonally selected after serial dilution.

Nwosu Z.C., Ward M.H., Sajjakulnukit P., Poudel P., Ragulan C., Kasperek S., Radyk M., Sutton D., Menjivar R.E., Andren A., Apiz-Saab J.J., Tolstyka Z., Brown K., Lee H.J., Dzierozynski L.N., He X., PS H., Ugras J., Nyamundanda G., Zhang L., Halbrook C.J., Carpenter E.S., Shi J., Shriver L.P., Patti G.J., Muir A., Pasca di Magliano M., Sadanandam A, & Lyssiotis C.A. (2023). Uridine-derived ribose fuels glucose-restricted pancreatic cancer. Nature, 618(7963), 151-158.

+ Open protocol

+ Expand

LMNA and NTRK1 Targeting Donor Constructs

Check if the same lab product or an alternative is used in the 5 most similar protocols

For the generation of the hygromycin-based donor template, 372-bp-long homology arm from LMNA and 433-bp-long homology arm NTRK1 were amplified by hES cells and cloned at the NotI-NheI (LMNA) and SalI-ApaI (NTRK1) in a plasmid previously described [8 (link)]. The frame of the plasmid was modified to allow the expression of the hygromycin gene from the LMNA gene promoter. For the generation of the puromycin based plasmid, the hygromycin marker was excised and replaced by the puromycin sequence at the AavrII-SalI sites. A new 461-bp-long homology arm was cloned at the NotI-NheI. The ETV6 and NTRK3 homology arms were amplified from hES cells and cloned into MV-PGK-Puro-TK [8 (link)] at the NotI-NheI and XhoI-AscI sites. The primers for the amplification of the homology arms are listed in Supplementary Table S2. sgRNA sequences were cloned into the dual Cas9/sgRNA expression vector pSpCas9(BB)-2A-Puro (PX459) (Addgene #48139) according to published protocol [30 (link)]. The oligos used are listed in Supplementary Table S3.

Vanoli F., Herviou L., Tsuda Y., Sung P., Xie Z., Fishinevich E., Min S.S., Mallen W., de Wardin H.D., Zhang Y., Jasin M, & Antonescu C.R. (2023). Generating in vitro models of NTRK-fusion mesenchymal neoplasia as tools for investigating kinase oncogenic activation and response to targeted therapy. Oncogenesis, 12(1), 8.

+ Open protocol

+ Expand

CRISPR-Mediated LRP1 Knockout Cell Line

Check if the same lab product or an alternative is used in the 5 most similar protocols

The LRP1 knockout cell line was generated by using the CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats/clustered regularly interspaced short palindromic repeat–associated 9) system as previously described.^{21 (link)} Candidate guide RNAs were designed using the Zhang Laboratory CRISPR Design website (http://crispr.mit.edu) to target LRP1 (Table IVA in the online-only Data Supplement). A plasmid based on gRNA_Cloning Vector (https://www.addgene.org/41824/) was used to express the guide RNA with the chosen protospacer sequence from the U6 promoter. pSpCas9(BB)-2A-Puro (PX459; https://www.addgene.org/62988/) was used to coexpress a human codon-optimized Cas9 gene with a C-terminal nuclear localization signal. HEK293T cell line was grown on 10 cm dish and assessed for efficacy with Surveyor assay. Single colonies were manually picked, dispersed, and replated individually to wells of 96-well plates. Colonies were subsequently screened by polymerase chain reaction and Sanger sequencing to identify insertion-deletion (Indels) at the target site. Several clones had compound heterozygote deletions flanking the target site (Table IVB in the online-only Data Supplement), and 3 were chosen for expansion and differentiation along with WT clones from the same 96-well plate. Absence of LPR1 protein expression was assessed by Western blot.

Oldoni F., van Capelleveen J.C., Dalila N., Wolters J.C., Heeren J., Sinke R.J., Hui D.Y., Dallinga-Thie G.M., Frikke-Schmidt R., Hovingh K.G., van de Sluis B., Tybjærg-Hansen A, & Kuivenhoven J.A. (2018). Naturally Occurring Variants in LRP1 (Low-Density Lipoprotein Receptor–Related Protein 1) Affect HDL (High-Density Lipoprotein) Metabolism Through ABCA1 (ATP-Binding Cassette A1) and SR-B1 (Scavenger Receptor Class B Type 1) in Humans. Arteriosclerosis, Thrombosis, and Vascular Biology, 38(7), 1440-1453.

+ Open protocol

+ Expand

CRISPR/Cas9-Mediated GFAT1 Knockout

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Expression vector pSpCas9(BB)-2A-Puro (PX459) (Addgene no. 48139) targeting GFAT1 was generated as previously described.^{33 (link)} Briefly, annealed oligonucleotides corresponding to the first exon of human GFAT1 (5′-CACCGCTTCAGAGACTGGAGTACAG-3′ and 5′-AAACCTGTACTCCAGTCT CTGAAGC-3′) were ligated into the BbsI restriction site in the plasmid to generate SpCas9-GFAT. H1299 or MCF7 cells were then transiently transfected with SpCas9-GFAT1 using Lipofectamine 2000 reagent (Invitrogen) following the manufacturer’s protocol. Then, 48 h post-transfection, 1 μg of mL⁻¹ puromycin and GlcNAc (10 mM) was added to the media for the next 72 h. The clonal selection was then performed through trypsinization and resuspension of a confluent 10 cm plate of either cell line into 10 mL of the appropriate media. Five μL of the cell mixture was then plated into a 20 cm plate with 20 mL of complete media with GlcNAc (10 mM). The media was replaced every 3 days until colonies of cells were established throughout the plate. About 10 days after plating, individual colonies were isolated using PYREX Cloning Cylinders (Corning) and trypsinization. Each clone was then propagated until confluency in a 10 cm dish before further characterization.

Walter L.A., Lin Y.H., Halbrook C.J., Chuh K.N., He L., Pedowitz N.J., Batt A.R., Brennan C.K., Stiles B.L., Lyssiotis C.A, & Pratt M.R. (2019). Inhibiting the Hexosamine Biosynthetic Pathway Lowers O-GlcNAcylation Levels and Sensitizes Cancer to Environmental Stress. Biochemistry, 59(34), 3169-3179.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!