The GBM tissues or GBM cells were added with RIPA buffer (Beyotime, Shanghai, China) containing protease inhibitors. The concentration of aboveextracted proteins was assessed with a BCA assay kit (Abcam, Cambridge, UK). The equal amount of protein samples (30 μg) was separated by 10% SDS‐PAGE and then transferred into the PVDF membranes (Invitrogen). The primary antibodies including anti‐YTHDF2 (ab220163, Abcam), anti‐EPHB3 (ab133742, Abcam), anti‐TNFAIP3 (ab92324, Abcam), anti‐pAkt (Ser473, #3787, Cell Signaling technology, Bossdun, USA), anti‐Akt (#2938, Cell Signaling), anti‐p65 (ab32536, Abcam), anti‐LaminB (sc‐374015, Santa Cruz Biotechnology, CA, USA) and β‐actin (ab8227, Abcam) were incubated with the PVDF membranes for overnight at 4°C. The samples were next incubated with the goat anti‐rabbit IgG (ab205718, Abcam) at 37°C for 2 h at room temperature.
Ab220163
Manufactured by Abcam
Sourced in United States, United Kingdom
Ab220163 is a lab equipment product. It serves as a core function, but a detailed description cannot be provided while maintaining an unbiased and factual approach.
Automatically generated - may contain errors
Lab products found in correlation
Ab220162, by Abcam (4 mentions)
Ab220161, by Abcam (4 mentions)
Ab195377, by Abcam (3 mentions)
Ab208577, by Abcam (3 mentions)
Ab220160, by Abcam (3 mentions)
Ripa buffer, by Beyotime (2 mentions)
Ab76302, by Abcam (2 mentions)
Nuclear and cytoplasmic protein extraction kit, by Beyotime (2 mentions)
Ab126605, by Abcam (2 mentions)
Ab220030, by Abcam (2 mentions)
Magna rip rna binding protein immunoprecipitation kit, by Merck Group (2 mentions)
Ab172730, by Abcam (2 mentions)
Ab186733, by Abcam (2 mentions)
Protease inhibitor cocktail, by Thermo Fisher Scientific (2 mentions)
Bca protein assay kit, by Thermo Fisher Scientific (2 mentions)
Magna rip kit, by Merck Group (2 mentions)
Ab133742, by Abcam (1 mentions)
Ab92324, by Abcam (1 mentions)
Ab205718, by Abcam (1 mentions)
Bca assay kit, by Abcam (1 mentions)
26 protocols using ab220163
1
Protein Extraction and Western Blot Analysis in GBM
2
RIP Assay for ALKBH5 and YTHDF2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
3
Nuclear and Cytoplasmic Protein Extraction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cytoplasm and nuclear fraction of cells were extracted using a nuclear and cytoplasmic protein extraction kit (Beyotime, Shanghai, China), according to the manufacturer’s instructions. Whole cell lysates or the nuclear/cytoplasm fractions were subjected to SDS-PAGE and immunoblotting, as described in our previously published study [24 (link), 25 (link)]. Primary antibodies against STAT3 (Abcam, ab119352), phosphorylated STAT3 (p-STAT3) (Abcam, ab76315), GAPDH (Abcam, ab181602), GNAS (Proteintech, 10,150–2-AP), YTHDF1 (Abcam, ab220162), YTHDF2 (Abcam, ab220163), YTHDF3 (Abcam, ab220161), P65 (Proteintech, 10,745–1-AP), phosphorylated P65 (pp65) (Abcam, ab76302), JAK1 (Abcam, ab133666), and JAK2 (Abcam, ab108596) were used.
4
RIP-qRT-PCR Assay for m6A Readers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RIP assays were performed essentially as described in our previously published study [24 (link), 25 (link)]. In brief, cells were lysed using polysome lysis buffer (5 mM HEPES (pH 7.4), 85 mM KCl, 1 mM DTT, 5 mM PMSF, 0.5% NP40, supplemented with RNase inhibitors (Invitrogen, USA) and PIC (protease inhibitors cocktail, Roche, Switzerland)) on ice for 10 min. After centrifugation, the supernatant was collected with 10% of the lysate serving as “input”. The remainder of the lysate was incubated with 50 μl of protein A/G magnetic beads (Life Technologies, USA) coupled with 2 μg of primary antibodies rotated overnight at 4 °C with IgG antibody as the control. RNA was isolated using TRIzol (Invitrogen, USA) and reverse-transcribed into cDNA for qRT-PCR detection using a Takara SYBR green kit (Takara, Japan). Primary antibodies against YTHDF1 (Abcam, ab220162), YTHDF2 (Abcam, ab220163), YTHDF3 (Abcam, ab220161), and N6-methyladenosine (m6A) (Abcam, ab220161) were used.
5
Comprehensive Analysis of m6A Regulators
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Ferrostatin-1 (S7243), necrostatin-1 (S8037), Z-VAD-FMK (S7023), liproxstatin-1 (S7699), sorafenib (S7397), erastin (S7242), RSL3 (S8155), MG-132 (S2619) were bought from Selleck Chemicals. CHX (C7698) and Act-D (129935) were purchased from Sigma-Aldrich. Anti-N6-methyladenosine antibody (ab208577), anti-METTL3 antibody (ab195352), anti-METTL4 (ab107540), anti-METTL14 antibody (ab220030), anti-FTO antibody (ab92821), anti-ALKBH5 antibody (ab195377), anti-YTHDF1 antibody (ab220162), anti-YTHDF2 antibody (ab220163), anti-YTHDF3 antibody (ab220161), anti-YTHDC2 antibody (ab220160), anti-HNRNPA2B1 antibody (ab31645), anti-ATG3 antibody (ab108282), anti-ATG4A antibody (ab223374), anti-ATG5 antibody (ab108327), anti-BECN1 antibody (ab207612), anti-ATG7 antibody (ab133528), anti-ATG9A antibody (ab108338), anti-ATG12 antibody (ab155589), anti-ATG16L1 antibody (ab187671), anti-LC3-I/II antibody (ab128025), anti-P62 antibody (ab109012), anti-NCOA4 antibody (ab86707), anti-FTH1 antibody (ab65080), and anti-beta actin (ab6276) antibody were purchased from Abcam Technology. Anti-WTAP antibody (sc-374280) was bought from Santa Cruz Biotechnology. Anti-Mouse IgG (G-21040) and anti-Rabbit IgG (G-21234) were bought from Thermo Fisher Scientific.
6
Quantifying m6A Modification in mRNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the m6A RIP assay, the Magna MeRIP m6A Kit (Merck Millipore) was used according to the manufacturer’s protocol. Briefly, total RNA of MSCs was extracted using TRIzol reagent and fragmented. Then, prepared Protein A/G magnetic beads conjugated with anti-m6A antibody (ab208577, Abcam), anti-YTHDF2 (ab220163, Abcam), or IgG control were added and incubated with fragmented RNA overnight. After that, the magnetic beads were collected, and the immunoprecipitated RNA was further collected and used to analyze the m6A enrichment of target genes by qPCR. Nonimmunoprecipitated RNA fragments were regarded as the input control, and the formulas used in the analysis are listed as follows:
ΔCTRIP = CTRIP – CTinput; (e3)
%input = 2(–ΔCTRIP); (e4)
ΔCTigG = CTigG – CTinput; (e5)
ΔΔCT = ΔCTRIP – ΔCTigG; (e6)
fold enrichment = 2–ΔΔCT. (e7)
The represented relative fold enrichment was normalized to the fold enrichment of the corresponding control group.
ΔCTRIP = CTRIP – CTinput; (e3)
%input = 2(–ΔCTRIP); (e4)
ΔCTigG = CTigG – CTinput; (e5)
ΔΔCT = ΔCTRIP – ΔCTigG; (e6)
fold enrichment = 2–ΔΔCT. (e7)
The represented relative fold enrichment was normalized to the fold enrichment of the corresponding control group.
7
Antibody-based Protein Characterization Protocols
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Antibodies against YTHDF2 (ab220163), O-GlcNAc (ab2739), OGA (ab124807), OGT (ab96718), K48 (ab271911) and p-Rb (ab173289) were obtained from Abcam (Cambridge, UK). Antibodies against MCM2 (10513-1-AP), MCM5 (11703-1-AP), and β-Tubulin (66240-1-Ig) were obtained from Proteintech (Rosemont, IL, USA). Antibody against HA (26183) was from Invitrogen (Carlsbad, CA, USA). Antibody against FLAG (F3165) was from Sigma-Aldrich (Germany). Antibody against H3 (H0164) was from Millipore (Massachusetts, USA). Antibodies against Rb (A16966), p21 (A21749), cyclinD1 (A2708) and CDK4 (A0366) were from ABclonal Technology (Wuhan, China). Antibodies against β-actin (TA-09), Goat rabbit IgG/TRITC, secondary (ZF-0316), and Goat mouse IgG/FITC, secondary (ZF-0312) were purchased from ZSGB-BIO (Beijing, China). Antibody against OGT (sc-74546, for immunofluorescence) was from Santa Cruz (CA, USA).
8
Modulating YTHDF2 Expression in Gastric Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
YTHDF2 antibody (Abcam, ab220163), FOXC2 antibody (ab24340), GSK-3β antibody (Abcam, ab93926), and Snail antibody (Abcam, ab229701) were purchased from Abcam. Over-expressed YTHDF2 lentiviral plasmid was purchased from GeneCopoeia. The shYTHDF2 plasmid was commissioned by Shanghai Genechem Co., Ltd. The sequence of shYTHDF2 is as follows: shYTHDF2 # 1 CCGGGCTACTCTGAGGACGATATTCCTCGAGGAATATCG TCCTCAGAGTAGCTTTTTG; shYTHDF2 # 2 CCGGTACTG ATTAAGTCAGGATTAACTCGAGTTAATCCTGACTTAATCA GTATTTTTG. The lentiviral system was used to package YTHDF2 or shYTHDF2 lentiviral particles, and then virally infect the gastric cancer cell lines. The finally established overexpression or knockout YTHDF2 cell line had undergone long-term puromycin screening.
9
Protein Expression Analysis via SDS-PAGE
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The proteins were obtained from cells and tissues being lysed with RIPA buffer and then separated by 10% SDS-PAGE. The anti-WTAP (ab195380, Abcam), anti-HMBOX1 (16123-1-AP, Proteintech), anti-YTHDF2 (ab220163, Abcam), anti-PI3K (ab191606, Abcam), anti-pPI3K (ab182651, Abcam), Akt (9272S, Cell Signaling), p-Akt (Ser473) (4051S, Cell Signaling), and anti-GAPDH (ab181602, Abcam) were used for PVDF membrane incubating overnight at 4 °C. The protein expression was detected by incubating with anti-rabbit secondary antibodies.
10
Western Blot Analysis of RNA Modification Enzymes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells or tumor tissues were lysed in RIPA lysis buffer with protease and phosphatase inhibitors (Beyotime). Thirty micrograms of total protein was subjected to SDS‐PAGE gels and subsequently transferred to PVDF membranes. The membranes were blocked and then incubated with primary Abs overnight at 4°C. After washing three times, the membranes were incubated with the secondary Abs for 2 h at room temperature. Finally, protein bands were visualized by a chemiluminescence imaging system (Tanon) using western chemiluminescent HRP substrate (ECL, Millipore). The following Abs were purchased: METTL3, METTL14, FTO, ALKBH5, and YTHDF2 (Cat. No. ab195352, ab220030, ab126605, ab195377, and ab220163, respectively; Abcam); ULK1, LC3B, and P62/SQSTM1 (Cat. No. 8054, 3868, and 88588, respectively; Cell Signaling Technology); ATG13 pS318 (Cat. No. 600‐401‐C49; Rockland); actin (Cat. No. A5441; Sigma‐Aldrich); and anti‐rabbit HRP‐linked Ab and anti‐mouse HRP‐linked Ab (Cat. No. 7074 and 7076, respectively; Cell Signaling Technology).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!