Nonspecific igg antibodies

ChIP assays were performed using a ChIP Assay Kit (Abcam) according to the manufacturer’s instructions. Briefly, cells were fixed, lysed, and sonicated to obtain DNA fragments in arranging in size from 200 to 1,000 bp. Chromatin was then precipitated with nonspecific IgG antibodies (Sigma), ChIP-grade rabbit anti-NR2F1 (Abcam), or ChIP-grade rabbit anti-H3 (Abcam). DNA was extracted and PCR was performed with primers for CXCL12, CXCR4 and CXCR7 promoter fragments.

ChIP assays were performed using a ChIP Assay Kit (Abcam) according to the manufacturer's instructions. Briefly, the minimum number of SACC‐LM or SACC‐83 cells was 1 × 10⁶ cells for every ChIP. These cells were fixed and lysed, and the extracted DNA was sheared by the sonicator to an optimal DNA fragment size of 200‐1000 bp. Chromatin was then precipitated with nonspecific IgG antibodies (Sigma), ChIP‐grade PRRX1 antibodies (Proteintech) or ChIP‐grade rabbit anti‐histone H3 (Sigma). Then, DNA was extracted and purified, and PCR was performed with primers for a PPARG2 promoter fragment.

ChIP assay was conducted with a ChIP assay kit (Upstate Biotechnology, Waltham, MA, USA) according to the manufacturer’s instructions. Briefly, cells were fixed with formaldehyde, lysed, and sonicated to obtain DNA fragments in a size from 200 to 1000 bp. Chromatin was then precipitated with non-specific IgG antibodies (Sigma, St. Louis, MO, USA) or mouse anti-E2F1 (sc-193x, Santa Cruz). DNA was extracted by phenolechloroform and precipitated by ethanol. PCR was performed with primers for three miR-17-92 promoter fragments (Promoter 1F: ACATGGTCCTTCGAGGTGC, Promoter 1R: CCCCACCCCTCGGCCTCG; Promoter 2F: TCACAGCAGTTGGGGAAACA, Promoter 2R: CTCCCCCAATCAGGACCTC; Promoter 3F: GCGGGCCGGGTGGGTCTC, Promoter 3R: GCCAGGACGGCCGCCCCA), and for a fragment containing miR-106a ORF (106a ORF F: CCACAATCAGTTTTGCATGG, 106a ORF R: TTTTGCAGATTTGCAGTTCA) at 55′C for 35 cycles.