Molpure cell tissue mirna kit

The MolPure Cell RNA Kit (Yeasen, China) was chosen for the extraction and purification of RNA from NSCLC tissues and cells. RNAs shorter than 200 nucleotides were extracted with MolPure Cell/Tissue miRNA Kit (Yeasen, China). The reverse transcription was executed using the Hifair III 1st-Strand cDNA Synthesis Kit with gDNA digester plus (Yeasen, China). To evaluate the expression levels of LDLRAD3, miR-20a-5p, and SLC7A5, the qRT-PCR process was achieved with the Q960 PCR instrument (Dinai, China) using the PC46-THERMOscript SYBR Green qRT-PCR Kit (Aidlab, China). The primer sequences were as follows: LDLRAD3 forward: 5′-CTT GCT GGA CCA GAG AAC ACA TG-3′, reverse: 5′-CAT GAG GTT GTT CCG CTT CCC A-3′; miR-20a-5p forward: 5′-UAC AGC GCA GAC AGU GCA GCU AG-3′, reverse: 5′-CUA GCU GAA CUA CGC ACU GUA-3′; SLC7A5 forward: 5′-GAA GTC ACC AAG TAC ACT GGA TGT-3′, reverse: 5′-GAA GTA GTC CAG GTT GGT CAG A-3′; U6 forward: 5′-GGA AGC TTG TCA TCA ATG GAT ATC-3′, reverse: 5′-TGA TGA CCC TTT TGG CTC CAA C-3′; and β-actin forward: 5′-CAT TGT TAC CAA CTG GGA CGA CAT-3′, reverse: 5′-GCC TCG GTG AGC AGC TTA CA-3′. The relative expression levels of LDLRAD3 and SLC7A5 mRNA were normalized with β-actin, and the relative expression level of miR-20a-5p was normalized with U6 via the 2^−ΔΔCt method.

Cell samples were treated with lysis buffer, and miRNA was separated from total RNA by using a MolPure^® Cell/Tissue miRNA Kit (Yeasen, Shanghai, China). For qPCR, specific stem-loop primers were used for reverse transcription following the instructions of a PrimeScript^TMRT reagent kit with gDNA Eraser (Takara, Beijing, China), and qPCR reactions were performed in a CFX96 Real-Time System using NovoStar SYBR qPCR SuperMix plus (Jinan, China). The qPCR program was as follows: 95 °C for 30 s, 40 cycles of 95 °C for 5 s, and 60 °C for 30 s. Data were analyzed using snRNA U6 and sw22934 (B. mori eukaryotic translation initiation factor 4A) as an endogenous control to quantify the expression levels of miRNA and mRNA, respectively, using the 2^−ΔΔCt method [28 (link)]. Meanwhile, small subunitribosomal RNA gene copies of N. bombycis were detected by qPCR to examine their proliferation in BmE cells.

Total RNAs from cells and tissues was extracted using Trizol reagent (Sigma-Aldrich, USA). Total miRNA was obtained using Molpure Cell/Tissue miRNA Kit (Yeasen, Shanghai, China). Additionally, mRNA was transcribed with Hifair III One Step RT-qPCR Probe Kit (Yeasen, Shanghai, China). At the same time, TaqMan MicroRNA Reverse Transcription Kit (Invitrogen, USA) was used to transcribe miRNA. SYBR green was obtained from Roche, Switzerland, and was used to perform real-time PCR. The primers in our experiments are listed in Table 2. U6 was used as the endogenous control for miR-195. The endogenous control for other primers was GAPDH. The 2^−∆∆Ct method was applied in determining the expressions of relative mRNA or miRNA [23 ].Table 2.

The primers used in this study

Gene	Primer 5ʹ→3’
MiR-26a	F: TGGCCTCGTTCAAGTAATCCAG
	R: GTCCCCGTGCAAGTAACCA
FOXO1	F: CAGCCGCCACATTCAACAGG
	R: GCTCTTGACCATCCACTCGT
GAPDH	F: GGAGCGAGATCCCTCCAAAAT
	R: GGCTGTTGTCATACTTCTCATGG
U6	F: CTCGCTTCGGCAGCACA
	R: AACGCTTCACGAATTTGCGT

Total RNA from NSCs and hippocampal tissue samples was extracted employing Trizol reagent (Invitrogen, Carlsbad, CA), and miRNAs from cells and hippocampal tissue samples were extracted utilizing miRNA extraction kit (19331ES08, MolPure ® Cell/Tissue miRNA Kit, Yeasen, Shanghai, China). The extracted RNA was reversely transcribed into complementary DNA (cDNA) from 500 ng of RNA by referring to the PrimeScript RT reagent Kit (RR047A, Takara, Japan). miRNA was reversely transcribed into cDNA utilizing microRNA Reverse Transcription Kit (EZBioscience, EZB-Exo-RN1). The synthesized cDNA was subjected to RT-qPCR with the Fast SYBR Green PCR kit (4364344, Applied biosystems, Foster City, CA) and the ABI PRISM7300 RT-qPCR system (Applied biosystems). GAPDH served as a normalizer for mRNA, and U6 for miRNA. The relative expression of genes or mRNAs was analyzed employing the 2^-ΔΔCt method. Primers are described in Table S1.

The femurs were collected from wild-type, Mir155-Tg, and Mir155-KO mice. And bones were ground with a high-speed low-temperature tissue homogenizer (Servicebio, China). As previously reported (Teng et al., 2022 (link)), the miRNAs were extracted from BMSCs and ground bone tissues with the MolPure Cell/Tissue miRNA Kit (Yeasen, China) as per the manufacturer’s instructions. The miRNA was further reversed by Tailing reaction using miRNA first strand cDNA synthesis kit (Accurate Biology, China). In brief, 3.75 μL miRNA, 5 μL 2×miRNA RT Reaction Solution, 1.25 μL miRNA RT Enzyme Mix were incubated at 37°C for 1 hr, 85°C for 5 min. The mRNAs from osteoclasts induced from Mir155-KO and wild-type mice were extracted with an RNA extraction kit (Accurate Biology, China) as per the manufacturer’s instruction. Total RNA (500 ng) was transcribed with reversed regents (Accurate Biology, China). RT-qPCR was performed using SYBR Green Premix Pro Taq HS qPCR Kit (Accurate Biology, China) on an AriaMx Real-time quantitative PCR machine (Agilent, USA). The PCR conditions were 95°C for 30 s, followed by 40 cycles at 95°C for 5 s and 60°C for 30 s. The fold change relative to the control group was measured by the 2^-∆∆Ct method. The primers used were shown in Table 1.

Keratinocytes (2×10⁴ cells/well) were seeded in a 48-well plate for 24 h, then the cells were treated with M5 mixed with ELE as described above for 48 h. For the Mø study, the cells were first resuspended in a medium containing LPS (100 ng/ml), IFN-γ (20 ng/ml), and ELE (100 μM), respectively. The cells (2×10⁵ cells/well) were then further seeded in a 48-well plate for 48 h. To identify the effects of ELE-pretreated M1-Mø, Mø was cultured in a medium containing LPS/IFN-γ or LPS/IFN-γ/ELE for 24 h. The medium was then discarded and replaced with fresh medium (without LPS/IFN-γ and ELE) for another 24 h. The conditioned medium (CM) was eventually collected and placed in dishes pre-seeded with keratinocytes for 48 h. Total RNA was extracted using MolPure Cell/Tissue miRNA Kit (Yeasen Biotechnology). The first strand cDNA was synthesized using HifairⅡ1st Strand cDNA Synthesis SuperMix for qPCR (Yeasen Biotechnology). qRT-PCR was performed using SYBR green reagent in an LightCycler 480 II (Roche, Swiss). Primers of targeted genes are listed in Table 1 below: