A. lyrata plants postflowering were used for total RNA isolation. Roots were recovered from soil, washed thoroughly with sterile water and dried with a clean tissue. Around 10 mg of ground roots were extracted with 600 μL of TRIzol reagent (ThermoFisher, Carlsbad, CA, USA). Chloroform (120 μL) was added to remove proteins and other impurities. After centrifugation (13,000×g; 10 min), an aliquot (400 µL) of supernatant was recovered and an equal volume of isopropanol added. Following mixing the pellet was recovered by centrifugation (10,000×g; 10 min) and washed with 70% ethanol. After centrifugation (10,000×g; 5 min) the pellet was dried at room temperature for 10 min. Sterilized water (30 μL) was then added to dissolve the total RNA. Reverse transcription reactions were performed using ≤2 μg of total RNA, random primers and a reverse transcription kit (Agilent, Santa Clara, CA, USA). The cDNA library was then used for amplification of the coding sequence of AlTHAA2 (AL8G20050). A pair of gene-specific primers attached with GATEWAY att sites were used (Fwd: GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGACACCATGAAGGTTGAAATC; Rev: GGGGACCACTTTGTACAAGAAAGCTGGGTTTTAGATCAATACACTTGGATTTG). cDNAs were cloned into the GATEWAY entry vector pDONR207 (Invitrogen).
Reverse transcription kit
Manufactured by Agilent Technologies
Sourced in United States
The Reverse Transcription Kit is a laboratory instrument designed for the conversion of RNA into complementary DNA (cDNA). This process, known as reverse transcription, is a crucial step in various molecular biology applications, such as gene expression analysis, RNA sequencing, and cDNA library construction.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Merck Group (3 mentions)
Taqman probe, by Thermo Fisher Scientific (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Gateway entry vector pdonr207, by Thermo Fisher Scientific (1 mentions)
Rneasy lipid tissue extraction kit, by Qiagen (1 mentions)
Turbo dnase treatment, by Thermo Fisher Scientific (1 mentions)
Sybr green real time pcr master mix kit, by Thermo Fisher Scientific (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Cfx96 real time system, by Bio-Rad (1 mentions)
7 protocols using reverse transcription kit
1
Isolation and cloning of AlTHAA2 from Arabidopsis lyrata
2
Cardiac Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from frozen LV tissue using Trizol reagent (Sigma) and 0.5 μg of RNA was reverse transcribed into cDNA using a reverse transcription kit (Agilent Technologies). mRNA expression was quantified by RT-qPCR using the following Applied Biosystems™ TaqMan™ probes: ANP (Assay ID: Mm01255748), TRAF3IP2 (Assay ID: Mm00506094_m1), IL-18 (Assay ID: Mm00434226), IL-6 (Assay ID: Mm00446191), IL-17A (Assay ID: Mm00439618-m1), IL-17F (Assay ID: Mm00521423-m1), Ccl2/MCP-1 (Assay ID: Mm00441242-m1), CD68 (Assay ID: Mm03047343-m1), AGTR1a/AT1 (Assay ID: Mm01957722-s1), ColIα1 (Assay ID: Mm00801666), ColIIIα1 (Assay ID: Mm1254476), CTGF (Assay ID: Mm01192932_g1), and LOX (Assay ID: Mm00495386). 18S rRNA (Assay ID: Hs99999901) served as a house keeping gene. All data were normalized to corresponding 18S levels and analyzed using 2−ΔΔCt method.
3
Quantifying Gene Expression in ALS Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from TA muscle of WT and hSOD1G93A mice using RNeasy Lipid Tissue extraction kit (QIAGEN Inc., Alameda, CA, USA) per the manufacturer’s protocol. The total RNA was purified from genomic DNA contamination using Turbo DNAse treatment (Ambion, Life Technologies, Carlsbad, CA, USA) then converted to cDNA by means of a reverse transcription kit (Agilent Technologies Inc., Santa Clara, CA, USA) per the manufacturer’s protocol. Commercially available gene-specific Taqman probes (Applied Biosystems, Life Technologies, Carlsbad, CA, USA) were used to amplify target gene of interest as described previously [8 (link)]. Relative target gene expression to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was determined using this formula: 2-∆CT where ∆Ct = (Ct target gene – Ct GAPDH) [20 (link)]. Final measures are presented as relative levels of gene expression in hSOD1G93A mice compared with expression in WT controls.
4
Gene Expression Analysis of EMT Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from cells using TRIzol (15596-026, Ambion, Rockford, IL) and cDNA generated using a Reverse Transcription Kit (#600559, Agilent Technologies), according to the manufacturer’s protocol. Quantitative analysis was performed using SYBR Green Real-Time PCR Master Mix Kit (#4472908, Invitrogen, Carlsbad, CA). The experiments were performed in triplicate for each sample and normalized to the housekeeping gene expression PUMILIO. The real time thermocycler Stratagene, model Mx3000P was used, using the program MxPro v2.0. The analysis was performed using the ΔΔCt method59 (link). PCR was performed using the following primer sets: ZEB1, (forward) 5′-TTCACAGTGGAGAGAAGCCA-3′, (reverse) 5′-GCCTGGTGATGCTGAAAGAG-3′; ZEB2, (forward) 5′-ATAAGGGAGGGTGGAGTGGA-3′, (reverse) 5′-CGCGTTCCTCCAGTTTTCTT-3′; SNAIL (forward) 5′-TTCCAGCAGCCCTACGACCAG-3′, (reverse) 5′-GCCTTTCCCACTGTCCTCATC-3′; SLUG, (forward) 5′-CATGCCTGTCATACCACAACC-3′, (reverse) 5′-CTTGGATGAGGTGTCGGATG-3′; CDH1, (forward) 5′-GAACGCATTGCCACATACAC-3′, (reverse) 5′-ATTCGGGCTTGTTGTCATTC-3′; SDC-1, (forward) 5′-GCCGCAAATTGTGGCTACT-3′, (reverse) 5′-GGTTCTGGAGACGTGGGAATAG-3′; and PUMILIO, (forward) 5′-CGGTCGTCCTGAGGATAAAA-3′, (reverse) 5′-CGTACGTGAGGCGTGAGTAA-3′.
5
Gene Expression Analysis of Cardiac Remodeling
6
PDZK1 mRNA Expression Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells (5 × 106) were collected after 48 hours of transfection, and total RNA was extracted by Trizol. 1 μg RNA was used to synthesis of cDNA according to the instructions of the reverse transcription kit (Agilent, USA). The mRNA expression of PDZK1 was determined by RT-PCR on the CFX96Tm real-time System (Bio-Rad, USA), as follow: 95°C, 3 min, then, 95°C20 s and 70°C 1 min for 40 cycles. The calculation method of relative expression used the comparative Ct (2−ΔΔCt) method [26 (link)], and each group was repeated 3 times.
7
Comprehensive Cardiac Gene Expression Analysis
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!