Both culture-dependent and culture-independent assays were conducted in parallel to quantify live and total bacterial loads in mosquitoes and their rearing water. Culture-dependent quantification of microbes was performed by culturing 40 μl of rearing water or 40 μl of 10-fold serial dilutions from individual mosquitoes (3 to 5 per treatment) homogenized in 500 μl PBS on LB plates at 37°C for 5 days. Plated dilutions that yielded distinct, countable colonies were enumerated for each mosquito sample. Each sample was plated in technical triplicates, and the mean colony count is reported. Culture-independent quantification of bacteria was performed by SYBR green real-time PCR (Thermo Fisher Scientific, Emeryville, CA) to amplify the 16S rRNA gene in samples from mosquitoes and water (5 to 10 per treatment). Bacterial culturing and quantitative PCR (qPCR) of mosquitoes were repeated twice for each rearing experiment. The mosquito data were normalized to an A. aegypti reference ribosomal protein S17 (RPS17) gene (82 (link)).
Sybr green real time pcr
Manufactured by Thermo Fisher Scientific
Sourced in United States
SYBR Green real-time PCR is a widely used method for quantifying gene expression and detecting the presence of specific DNA sequences. It utilizes the SYBR Green dye, which binds to double-stranded DNA, allowing the amplification of target sequences to be monitored in real-time during the PCR process. This technique provides a simple and cost-effective approach for various applications in molecular biology and genetics research.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (4 mentions)
Trizol, by Thermo Fisher Scientific (3 mentions)
Superscript 3 first strand synthesis system, by Thermo Fisher Scientific (2 mentions)
Abi 7500 system, by Thermo Fisher Scientific (2 mentions)
Easypure rna kit, by Transgene (2 mentions)
All in one first strand cdna synthesis supermix, by Transgene (2 mentions)
Miscript 2 rt kit, by Qiagen (2 mentions)
Superscript 2 reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Qscript cdna synthesis kit, by Quantabio (1 mentions)
Total rna mini plus, by A&A Biotechnology (1 mentions)
Rneasy kit, by Qiagen (1 mentions)
Affinityscript, by Agilent Technologies (1 mentions)
Random hexamer, by Thermo Fisher Scientific (1 mentions)
Messageamp 2 arna amplification kit, by Thermo Fisher Scientific (1 mentions)
Steponeplus detection system, by Thermo Fisher Scientific (1 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
Agilent 2100b bioanalyzer, by Agilent Technologies (1 mentions)
All in one qpcr mix kit, by GeneCopoeia (1 mentions)
Rabbit ig control, by Abcam (1 mentions)
Lightcycler 480, by Roche (1 mentions)
21 protocols using sybr green real time pcr
1
Quantification of Mosquito Microbiome
2
Quantitative Real-time PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted and cDNA was synthesized as described previously [21] (link). Quantitative Real-time PCR was performed with a 7500 Fast Real-Time PCR System using SYBR® Green Real-Time PCR (Thermo Fisher Scientific, Waltham, MA, USA). Expression of genes was normalized to Gapdh according to the ΔCt method [22] (link). Primer sequences are listed in Supplementary Table 2 .
3
Osteogenic Differentiation of hASCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from hASCs from the experimental and control groups at day 7, day 14, and day 21 using the RNA extraction kit. Total RNA was extracted with TRIzol (Invitrogen, Carlsbad, CA, USA). The RNA concentration was determined using a spectrophotometer. Using reverse transcription reagents (Beyotime, China), 1 μg of total RNA was reverse transcribed to cDNA. The expression of osteocalcin (OCN), osteopontin (OPN), collagen type I (COL-1), runt-related transcription factor 2 (RUNX-2), BMP-2, and ALP were detected by qRT-PCR. The primer sequences of osteogenic genes are shown in Table 1 . PCR was performed using the SYBR Green Real-Time PCR (Thermo Fisher Scientific, Waltham, MA, USA), which allowed real-time quantitative detection of the PCR products by measuring the increase in SYBR green fluorescence caused by the binding of SYBR green to double-stranded DNA. Each PCR sample had a volume of 20 μL, and the reaction conditions were as follows: pre-denaturation at 95°C for two minutes; then 95°C for 10 seconds, 60°C for 30 seconds, and 72°C for 30 seconds for a total of 40 cycles. GAPDH was used as the control for normalization. The relative quantity of mRNA was calculated (2−ΔΔCt analysis).
4
Real-Time PCR Protocol for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Purified RNA was converted into First-Strand cDNA using SuperScript II Reverse Transcriptase (Life Technologies) according to manufacturer instructions. The cDNA was then analysed by the SYBR Green Real-Time PCR (Life Technologies). Primer design was completed using Primer3 with the following conditions: “Primer size – 20 bp, Primer melting point - 60°C, Primer G-C content – 55 % and Product size – 100 bp minimum, 150 bp optimum, 200 bp maximum”. The final PCR reaction volume was 20 μl with forward and reverse primer concentrations at 10 μM (Additional file 1 : Table S1). The templates used were either mouse, bat or NBV cDNA. The cycle conditions were: “Holding stage - 50°C for 2 min and 95°C for 2 min; Cycling stage - 95°C for 15 sec and 60°C for 1 min for 40 cycles and a melt curve stage of 95° for 15 sec, 60°C for 1 min and 95°C for 15 sec” on an ABSciex StepOne 7500 Plus Real-Time PCR System.
The real-time PCR threshold cycle (Ct) data were exported into an Excel spreadsheet and the Ct value differences between samples were calculated with the relative expression software tool (REST) [35 (link)] where the expression levels of target genes were normalised against a reference gene, Gapdh.
The real-time PCR threshold cycle (Ct) data were exported into an Excel spreadsheet and the Ct value differences between samples were calculated with the relative expression software tool (REST) [35 (link)] where the expression levels of target genes were normalised against a reference gene, Gapdh.
5
Measuring CHOP mRNA Expression
6
Gene Expression Quantified by SYBR Green Real-Time PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Gene expression was measured by SYBR Green real-time PCR (Applied Biosystems, Grand Island, NY, USA) according to manufacturer’s protocols. All primers used are listed in Table 1 . Final measures are presented as relative levels of gene expression in hSOD1G93A mice compared with expression in WT as described previously [12 (link)].
| TLR4 | Forward: 5′ - ATGCATGGATCAGAAACTCAGCAA - 3′ | 249 |
| Reverse: 5′ - AAACTTCCTGGGGAAAAACTCTGG - 3′ | ||
| HMGB1 | Forward: 5′ - GCTCTCACAGCCATTGCAGTACAT - 3′ | 129 |
| Reverse: 5′ - AGGATCTCCTTTGCCCATGTTTAG - 3′ | ||
| GAPDH | Forward: 5′ - AGGTCGGTGTGAACGGATTTG - 3′ | 123 |
| Reverse: 5′ - TGTAGACCATGTAGTTGAGGTC - 3′ |
TLR4, toll-like receptor 4; HMGB1, high-mobility group box 1; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.
7
RNA Isolation and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated using Total RNA Mini Plus (A&A Biotechnology, Gdańsk, Poland). Complementary DNA (cDNA) was synthetized using qScriptTM cDNA Synthesis Kit (Quantabio, Beverly, MA, USA). SYBR Green real time—PCR was carried out according to the manufacturer’s instructions (Applied Biosystems, Waltham, MA, USA). qPCR signals (cT) in each experimental group were normalized to GAPDH levels.
8
RNA Isolation and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated from cells with Trizol followed by QIAgen RNEasy Kit (Qiagen, Crawley, UK) with additional DNase step. cDNA was prepared from mRNA with AffinityScript (Agilent Technologies, CA, USA) per manufacturer instructions. SYBR green real-time PCR was performed (Applied Biosystems, CA, USA) with ABI Prism 7900HT sequence detection system (AB) and all samples were normalized to GAPDH, the housekeeping gene.
9
Real-time PCR validation of differentially expressed genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Statistically significant differentially expressed genes were further validated by SYBR Green real-time PCR (Applied Biosystems, Carlsbad, CA, USA), using the same RNA samples previously used for PCR arrays. RNA was first amplified using Message AmpII aRNA amplification kit (Ambion Carlsbad, CA, USA) according to the manufacturer’s instructions and then reverse-transcribed using random hexamers (Applied Biosystems Carlsbad, CA, USA). Primer sequences were designed with Primer3 on line software (http://primer3.ut.ee/ ) and synthesized by Eurogentec-France. Data analysis was performed as described above.
10
Th Cell Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cellular RNA was extracted by using an EasyPure RNA Kit (TransGen Biotech). And cDNA was synthesized by using an All-in-One First-Strand cDNA Synthesis SuperMix (TransGen Biotech). The expression of Il9, Il24, Il4, Il5, Il13,Erg, Npas2, Id1, Ahr, Maf, Rbpj, Foxo1, Mef2c, Elk3, Csrnp1, Stat5a, Stat5b, Nfil3, Jun, Runx1, Gzmb, Il10, Ccnd3, Erdr1, Slfn1, Lsp1 by Th cells were analyzed with SYBR Green real-time PCR (Applied Biosystems). Gene expression was normalized to the housekeeping gene Gapdh. Gene primers are shown in Table S3 in supplemental information .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!