Qscript xlt cdna supermix

Manufactured by Quanta Biosciences

Sourced in United States

The QScript XLT cDNA SuperMix is a ready-to-use solution for reverse transcription and cDNA synthesis. It contains all the necessary components, including a reverse transcriptase enzyme, buffers, and dNTPs, to efficiently convert RNA into complementary DNA (cDNA).

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

QScript cDNA XLT cDNA Synthesis SuperMix QScript XLT cDNA SuperMix kit QScript cDNA SuperMix QScript Supermix

21 protocols using qscript xlt cdna supermix

RNA Extraction and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted with RNeasy Kit (Qiagen), and cDNA was synthesized with qScript™ XLT cDNA SuperMix (Quanta Biosciences). SYBR Green method and QuantStudio™ 12K Flex Real-Time PCR System (Applied Biosysterm) was used for quantative RT-PCR with primers listed below. The expression of mRNA was normalized to that of mRNA encoding 18S.

Lai L., Reineke E., Hamilton D.J, & Cooke J.P. (2019). A Glycolytic Switch is Required for Transdifferentiation to Endothelial Lineage. Circulation, 139(1), 119-133.

+ Open protocol

+ Expand

Gene Expression Analysis by qRT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Synthesis of cDNA was performed with the qScript™ XLT cDNA SuperMix (Quanta Bioscience). Gene expression of PGC1α, MITF, RARβ, p14^ARF, UCP2, ATP5g1, COX5A and NDUFS3 was determined with quantitative real-time PCR on Roche LightCycler 2.0 using the LightCycler FastStart DNA MasterPLUS SYBR Green I kit (Roche). Primers are listed in Supplementary Table 1.

Abildgaard C., Dahl C., Abdul-Al A., Christensen A, & Guldberg P. (2017). Inhibition of retinoic acid receptor β signaling confers glycolytic dependence and sensitization to dichloroacetate in melanoma cells. Oncotarget, 8(48), 84210-84223.

+ Open protocol

+ Expand

Total RNA Isolation and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from TM cells using Applied Biosystems PicoPure RNA Isolation Kit (ThermoFisher Scientific) (Phuong et al., 2017 (link)). 1 μg of total RNA was used for complementary DNA synthesis. RNA was reverse transcribed using qScript XLT cDNA Supermix (Quanta Biosciences). PCR was performed using Apex qPCR 2x Master Mix (Genesee Scientific) with Applied Biosystems Veriti Thermal Cycler (ThermoFisher Scientific). PCR conditions were as follows: 95°C for 15min; 95°C for 20s, 60°C for 60s, 40 cycles. PCR products were run on a 2% agarose gel at 90V for 30min. The DNA bands were visualized by Ethidium Bromide staining along with 100-bp DNA ladder (IBI Scientific) using a FluorChemQ gel imaging system (Cell Biosciences).

Yarishkin O., Phuong T.T., Baumann J.M., De Ieso M.L., Vazquez-Chona F., Rudzitis C.N., Sundberg C., Lakk M., Stamer W.D, & Križaj D. (2020). Piezo1 channels mediate trabecular meshwork mechanotransduction and promote aqueous fluid outflow. The Journal of physiology, 599(2), 571-592.

+ Open protocol

+ Expand

Transcriptional Response of AGS Cells to H. pylori

Check if the same lab product or an alternative is used in the 5 most similar protocols

AGS cells (1 x 10⁵) were cultured in 12-well plates for 72 h. The medium was replaced in each well and the cells were exposed (or not) to H. pylori (MOI of 10:1) or 100 μm iron sulphate for 30 min, 3 h and 12 h before the total RNA was extracted (RNeasy Mini Kit, Qiagen, Hilden, Germany). Total RNA content was measured using a NanoDrop spectrophotometer (Nanodrop Technologies, Montanin, DE). Samples were treated with DNase I at 37°C for 30 min, followed by 10 min at 75°C and 5–10 min at 4°C. First strand cDNA was synthesised from total RNA (1 μg) using qScript XLT cDNA Supermix (Quanta Biosciences, Beverly, MA).

Flores S.E., Aitchison A., Day A.S, & Keenan J.I. (2017). Helicobacter pylori infection perturbs iron homeostasis in gastric epithelial cells. PLoS ONE, 12(9), e0184026.

+ Open protocol

+ Expand

Mpzl2 Expression Profiling in Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols

To check the expression of Mpzl2 in different tissues, lung, liver, kidney, brain and cochlea were dissected from P15 wild type mice. In addition, the cochlea expression of Mpzl2 was checked in embryos of 17.5 dpc. Total RNA was isolated with TRIzol Reagent (Invitrogen) according to manufacturer’s instructions. Prior to reverse transcription, RNA samples were treated with rDNAse I (DNA-free kit, Applied Biosystems). cDNA was synthetized using qScript XLT cDNA SuperMix (Quanta Biosciences). The primers used to amplify a 233 bp fragment of the Mpzl2 transcript were: forward 5′-GCTTGTGCTTCCACTTCTCC-3′ and reverse 5′-TGAAGGGGTCCATGTGGTAG-3’. For Gapdh, a 129 bp fragment was amplified with 5’-AGGTCGGTGTGAACGGATTTG-3’ forward primer and 5’-TGTAGACCATGTAGTTGAGGTCA-3’ reverse primer.

Bademci G., Abad C., Incesulu A., Rad A., Alper O., Kolb S.M., Cengiz F.B., Diaz-Horta O., Silan F., Mihci E., Ocak E., Najafi M., Maroofian R., Yilmaz E., Nur B.G., Duman D., Guo S., Sant D.W., Wang G., Monje P.V., Haaf T., Blanton S.H., Vona B., Walz K, & Tekin M. (2018). MPZL2 is a novel gene associated with autosomal recessive nonsyndromic moderate hearing loss. Human genetics, 137(6-7), 479-486.

+ Open protocol

+ Expand

Quantifying Exon-Specific CPT1 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

5 μg of total RNA was treated with DNase using the DNA-Free turbo kit according to manufacturer’s protocol (Life Technologies). 0.25 μg of DNase-treated RNA was reverse transcribed using qScript XLT cDNA SuperMix (Quanta Biosciences) according to manufacturer’s protocol. cDNA product was amplified via qPCR using 1 μL cDNA, 1X PowerUp SYBR Green Master Mix (Applied Biosystems), and 0.2 μM primers in a 25 μL reaction. Samples were placed in a Step-One Plus qPCR machine starting with an incubation for 2 min at 50°C and 2 min at 95°C followed by 40 cycles of 30 sec at 95°C, 60 sec at 60°C, and 30 sec at 72°C. After the cycling conditions, a melt curve was performed. The primers used for exon 6A-containing CPT1 were: (Forward: 5′CCGCTGGTTTGACAAGTG3′, Reverse: 5′TCATCGACGATCAGGTTCTC3′) [8 (link)]. Primers used for exon 6B-containing CPT1 were: (Forward: 5′AATGGTCGCGTTGGCTTC3′, Reverse: 5′TCCCAAAACCGGTGCATC3′) (Price et al., 2010). Primers used for rp49 were: (Forward: 5′GACGCTTCAAGGGACAGTATCTG3′, Reverse: 5′AAACGCGGTTCTGCATGAG3′). Primers used for tra2 were: (Forward: 5′GAACATCCACAAGCAAGCCG3′, Reverse: 5′ATACGGCGACCATCCACTTC3′). The relative expression of CPT1 and tra2 were normalized by dividing by rp49 expression levels.

Mikoluk C., Nagengast A.A, & DiAngelo J.R. (2017). The splicing factor transformer2 (tra2) functions in the Drosophila fat body to regulate lipid storage. Biochemical and biophysical research communications, 495(1), 1528-1533.

+ Open protocol

+ Expand

qPCR analysis of BPA/BPS exposure in C. elegans

Check if the same lab product or an alternative is used in the 5 most similar protocols

Sodium hypochlorite-treated eggs were placed on cholesterol-free NGM plates with 500 μM BPA or BPS as described above. Total RNA was extracted from adult worms or dissected germlines at 24 hours post-L4 with TRIzol following the manufacturer’s protocol. cDNA was synthesized with qSCript XLT cDNA SuperMix (Quanta Biosciences). qPCR was performed on an Applied Biosystems StepOnePlus realtime-PCR machine with Maxima SYBR Green qPCR Master Mixes (Thermo Scientific). Thermal cycling condition was 1x 95°C, 10 min, followed by 40x 95°C, 15s; 55°C, 30s; 72°C, 30s followed by 72°C, 5min. Melting curve analysis was performed to verify the specificity of the PCR amplicons. Primer sequences are shown in the S2 Table. Genes used for RNA-seq validation were C04G2.9, C40H1.8, col-133, gpx-3, ugt-18, ugt-36, Y65B4BR.1, ttr-44, Y111B2A.1, pqn-98, dsbn-1, K08E4.2, sgca-1, W08E12.8, C48B4.8, inx-17, F58F9.3 and clec-169.

Chen Y., Shu L., Qiu Z., Lee D.Y., Settle S.J., Que Hee S., Telesca D., Yang X, & Allard P. (2016). Exposure to the BPA-Substitute Bisphenol S Causes Unique Alterations of Germline Function. PLoS Genetics, 12(7), e1006223.

+ Open protocol

+ Expand

Synchronized Worm Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Synchronized worms were harvested at the young-adult stage, as for Western Blotting. RNA was isolated using TRIzol reagent (Invitrogen) and was transcribed into cDNA using qScript XLT cDNA SuperMix (Quanta Biosciences). Real-time PCR was performed on a CFX96 qPCR system (Bio-Rad) with the Luna Universal Probe qPCR Master Mix (NEB) according to the manufacturer's instruction. The following primers are used: LET-60 forward: 5’- GTCAGTGAGACAGCAAAGGGT-3’, reverse: 5’-CGTGACGCTCACGATGCTTG-3’; PMP-3 forward: 5’-GTTCCCGTGTTCATCACTCAT-3’, reverse: 5’-ACACCGTCGAGAAGCTGTAGA-3’. The gene pmp-3 was used as the normalisation control.

Kramer-Drauberg M., Liu J.L., Desjardins D., Wang Y., Branicky R, & Hekimi S. (2020). ROS regulation of RAS and vulva development in Caenorhabditis elegans. PLoS Genetics, 16(6), e1008838.

+ Open protocol

+ Expand

Gene Expression Analysis of Human IVD Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

SCF gene expression was also analyzed in human IVD cells from autopsy for each region using qRT-PCR with 1.0 × 10⁶ cells from each group (NP, AF and EP). RNA was extracted by centrifuging the cells at 2,000 × G for 5 minutes, removal of media, and addition of 0.3 mL of Lysis Buffer (Life Technologies) with 1% 2-mercaptoethanol and an equal volume of 70% ethanol. Binding, washing, and elution was carried out using the PuraLink RNA Mini Kit as per manufacturer’s instructions (Life Technologies) and samples converted to cDNA using qScript XLT cDNA SuperMix (Quanta Biosciences). Data was analyzed using the comparative 2 delta delta Ct method, where mRNA levels were normalized to the endogenous control (18 s) and experimental controls⁷³.

Wiet M.G., Piscioneri A., Khan S.N., Ballinger M.N., Hoyland J.A, & Purmessur D. (2017). Mast Cell-Intervertebral disc cell interactions regulate inflammation, catabolism and angiogenesis in Discogenic Back Pain. Scientific Reports, 7, 12492.

+ Open protocol

+ Expand

Quantification of Gene Expression in Mouse CE

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from mouse CE sheets using Arcturus PicoPure RNA Isolation Kit (Applied Biosystems (Foster City, CA, USA)) according to the manufacturer instructions. First-strand cDNA synthesis and PCR amplification of cDNA were performed using qScript XLT cDNA Supermix (Quanta Biosciences (Beverly, MA, USA)). The RT-PCR products were run on 2% agarose gels and visualized by ethidium bromide staining, along with 100-base pair DNA ladder (Thermo Scientific). Sybergreen based real-time PCR was performed using Apex qPCR GREEN Master Mix (Genesee Scientific). The comparative C_T method (ΔΔC_T) was used to measure relative gene expression in which the fold enrichment was calculated as: 2 − ^[^Δ^{CT (sample) −}^Δ^{CT (calibrator)]} after normalization. The results were performed in triplicate of at least four separate experiments and expressed as a relative fold change in gene expression compared with the control. To normalize fluorescence signals, GAPDH and α-tubulin were utilized as endogenous controls. The primer sequences and expected product sizes are given in the Table.

Lapajne L., Lakk M., Yarishkin O., Gubeljak L., Hawlina M, & Križaj D. (2020). Polymodal Sensory Transduction in Mouse Corneal Epithelial Cells. Investigative Ophthalmology & Visual Science, 61(4), 2.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!