Qiaseq fastselect rrna plant kit

For library construction (Figure 5C), DNA contamination was removed from total RNA extracted using the RapidOut DNA Removal Kit (Thermo Fisher Scientific, Waltham, MA, USA). QIAseq FastSelect rRNA Plant Kit (Qiagen, Hilden, Germany) was used to remove wheat rRNA (ribodepletion) and purified with AMPure XP beads (Beckman Coulter, Brea, CA, USA). The purified RNA concentration was measured using a Qubit 4 Fluorometer (Thermo Fisher Scientific, Waltham, MA, USA). Libraries were prepared using the Direct cDNA Sequencing Kit (SQK-DCS109; Oxford Nanopore Technologies, Oxford, UK) following the manufacturer’s instructions and previous studies [31 (link),53 (link)]. The prepared libraries were loaded on one Flongle Flow Cell (FLO-FLG001, R9.4.1; Oxford Nanopore Technologies, Oxford, UK) per sample, and the sequencing run was started on a MinION device with a Flongle adapter (Oxford Nanopore Technologies, Oxford, UK). Sequencing was performed for 24 h using MinKNOW software (version 21.11.7; Oxford Nanopore Technologies, Oxford, UK) and base-calling in High-accuracy mode with Guppy (version 5.1.12; Oxford Nanopore Technologies, Oxford, UK). Sequencing adapters were removed with Geneious Prime (version 21.1.1). Viruses were identified in ‘What’s in my Pot?’ (WIMP) workflow of EPI2ME Agent (version 3.4.2) and NCBI BLASTn using FASTQ files generated by the ONT platform.

For molecular work, all surfaces and equipment were made RNase-free using the RNase AWAY decontamination reagent (Thermo Fisher Scientific, 7002). Anther tissue was ground using a mortar and pestle in liquid nitrogen. Total RNA was extracted using Direct-zol™ RNA MiniPrep Kit, following the manufacturer’s protocol (Zymo Research, Irvine, CA, USA). The RNA concentration and quality were determined by a Qubit 3.0 fluorometer (Thermo Fisher Scientific). Samples having RNA integrity number (RIN) values of at least 7 were used for sequencing. The libraries for RNA-seq were prepared with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB, Ipswitch, MA, USA). Briefly, ribosomal RNA was depleted from 400 ng of total RNA using the QIAseq FastSelect rRNA Plant Kit (Qiagen, Hilden, Germany). The depleted RNA was fragmented, end-prepped, adapter-ligated, and the libraries were amplified according to the manufacturer’s instructions. The quality of the libraries was checked on the 4200 TapeStation System using D1000 Screen Tape (Agilent Technologies, Palo Alto, CA, USA), and the quantity was measured on Qubit 3.0. Sequencing was performed on the NovaSeq 6000 system (Illumina, San Diego, CA, USA) with a 2 × 150 bp paired-end run configuration. Every sample had three biological replicates that were sequenced independently.

The step-by-step protocol for the construction of the sequencing library is available online at https://forgemia.inra.fr/guillem.rigaill/nanopore_chloro (accessed on 18 October 2021). Briefly, 10 fmoles of the RNA oligo /5Phos/rNrNrNrNrUrGrArArUrGrCrArArCrArCrUrUrCrUrGrUrArC/3InvdT/ (IDT Technologies, Leuven, Belgium) was ligated to the 3′ end of 100 ng of total RNA using 10 U of T4 RNA ligase 1 (NEB, Evry, France). Ligated RNA was depleted of rRNA using the QIAseq FastSelect -rRNA Plant Kit (QIAGEN, Les Ulis, France) before a full-length cDNA synthesis using the SMARTScribe™ Reverse Transcriptase (Takara, Saint Germain en Laye, France) and the oligos AAGCAGTGGTATCAACGCAGAGTACrGrG + G and AAGCAGTGGTATCAACGCAGAGTACGTACAGAAGTGTTGCATTC (IDT Technologies, Leuven, Belgium). Full-length cDNAs were amplified with the SeqAmp DNA Polymerase (Takara, Saint Germain en Laye, France) using the AAGCAGTGGTATCAACGCAGAGTAC primer and purified with AMPure XP beads (Beckman-Coulter, Villepinte, France). 35 fmoles of amplified cDNAs were converted to a nanopore sequencing library with the PCR barcoding kit (Oxford Nanopore Technologies, Oxford, UK) and then sequenced on an R10.3 MinIon flow-cell (Oxford Nanopore Technologies, Oxford, UK).