Sanger method

pDEST-pcDNA5-BirA∗-FLAG N-term and pDEST-pcDNA5-BirA-FLAG-GFP were a gift from Dr Anne-Claude Gingras (Lunenfeld-Tanenbaum Research Institute at Mount Sinai Hospital). The entry clones pENTR221 CK2A1 and pENTR221 PRKACA were purchased from DNAFORM and RIKEN BRC through the National BioResource Project of the MEXT/AMED, Japan, respectively. CK2A1 or PRKACA coding sequences were cloned into the destination vector pDEST-pcDNA5-BirA∗-FLAG N-term with LR clonase 2 (Thermo Fisher Scientific) using the Gateway system. Sequences of all constructs were confirmed by the Sanger method (Genewiz).

The PCR products were purified using the Qiagen PCR purification kit as per the manufacturer’s instructions (QIAGEN, CA, USA). The purified products of all the four genes were sequenced bidirectionally using Sanger method (Genewiz INC, NJ, USA). Sequences were manually cured and Expasy translate software was used for translation of the sequences. Clustal X 2.1 was used for performing multiple sequence alignment (MSA) to see intraspecific variation (SNPs) if any, among the sequences on comparison with Sal-I reference sequence.

Plasmodium falciparum samples were genotyped using PCR or nested PCR followed by Sanger sequencing to evaluate mutations at pfcrt gene (codons 72–76), pfdhfr gene (codons 51, 59, 108, and 164), and pfdhps gene (codons 436, 437, 540, and 581). Primer sequences and PCR cycling conditions for each gene are reported elsewhere [12 (link)–14 (link)]. Briefly, primary PCR was performed with 1 μL genomic DNA, 7.5 μL of 2X master mix (Promega, Madison, WI, USA), and 0.27 μM each primer in 15 μL final volume for pfdhfr and dhps genes. Conditions for pfcrt gene were the same, except 1.2 μL of DNA and a final concentration of 0.33 μM each primer. Nested PCR was done for pfdhps and pfcrt genes. PCR products were purified with ExoSAP-it reagent (New England Biolabs, Ipswich, MA, USA) and sequenced using the Sanger method (Genewiz INC, NJ, USA). Laboratory P. falciparum strains, 3D7 and 7G8, were used as wild-type and mutant-type controls, respectively. Sequence analysis was performed using Geneious® 7.1.7 software (Biomatters, Auckland, New Zealand) using the P. falciparum 3D7 reference strain for pfcrt (PF3D7_0709000), pfdhfr (PF3D7_0417200), and pfdhps (PF3D7_0810800) genes. Mutant alleles were identified, and the frequency of each allele was determined.

Total RNA was extracted by using the RNeasy kit (Qiagen, Inc., Gaithersburg, MD, United States) following the manufacturer’s instructions. Reverse transcription was carried out using the Uni12 primer (5′-AGCAAAAGCAAGG-3′) and avian myeloblastosis virus (AMV) reverse transcriptase (Takara) following the manufacturer’s instructions and the cDNA products were stored at −80°C until use. The eight segments of influenza A virus were amplified by PCR using universal primers (Wang et al., 2017 (link)) and Phusion high-fidelity DNA polymerase (Vazyme, Inc., Nanjing, China). The PCR products were cloned into the pHW2000 vector using an in vitro recombination approach (Wang et al., 2017 (link)). The cloned plasmids were confirmed by sequencing with the Sanger method (Genewiz, Inc., Suzhou, China) with primers: 5′-CGCAAATGGGCGGTAGGCGTG-3′ (CMV-Forward) and 5′-TAGAAGGCACAGTCGAGG-3′ (BGH-Reverse). The eight segments of H9N2 virus were analyzed and aligned by using MEGA6 software (Tamura et al., 2013 (link)).

RT-PCR reactions were carried out to extend the genomic sequence of a novel umbravirus isolated from sugarcane variety BJ790038, for which four short contigs (131–325 nt) were recovered using the VANA-based metagenomics approach. PCR reactions were performed using the Qiagen OneStep RT-PCR Kit. Ten primers were designed (Table S1) based on the four contig sequences. The 25 μL RT-PCR reaction mix consisted of 1 μL of eluted RNA, 14.5 μL of RNase-free water, 1µl of RNase inhibitor (RNase-Out, Invitrogen), 5 μL of RT-PCR buffer (5X), 0.5 μL of dNTPmix (10 mM), 1 μL of each primer (10 μM), and 1 μL of the RT-PCR enzyme mix. The RT-PCR program was as follows with the extension time (Ext) for each primer pair listed in Table S1: 50 °C for 30 min, 95 °C for 15 min, 35 cycles at 94 °C for 1 min, annealing temperature 55 °C for 1 min, and 72 °C for Ext with a final 72 °C extension for 10 min. PCR products were analyzed by electrophoresis using a 1.2% agarose gel in TAE buffer stained with ethidium bromide and visualized under UV light. Amplification products were sequenced using the Sanger method (Genewiz, Leipzig, Germany).

PCR amplification of the coding region around the exon 9 of the TRPC3 cDNA was performed on total cDNA from EDL of WT and DMD^mdx rats. PCR was performed using LA Taq polymerase (Takara, Kusatsu, Japan) and the primers published by Kim and collaborators [36 (link)]: Forward: CAGTGATGTAGAGTGGAAGTTTGC, Reverse: CTCCCTCATTCACACCTCAGC. The amplification products were loaded on a 2% agarose gel. The amplification of the full-size cDNA of TRPC3 was performed using the following primers: Forward: ACGCAGTACGGCAACATCC, and Reverse: CATTCACACCTCAGCGCACT. The amplification products were then sequenced with Sanger method (Genewiz, South Plainfield, USA).