Genomic DNA from offspring MLN cells and SPCs was isolated using an AllPrep mini DNA kit (Qiagen, MD). DNA from the spleens of approximately 1 week old offspring mice (unsensitized) and DNA from maternal peripheral blood leucocytes (PBL) post challenge were extracted using DNeasy Tissue/Blood kit (Qiagen, MD) as previously described.(42 (link)) Isolated DNA was then bisulfite converted using an Epitect plus DNA Bisulfite kit (Qiagen, MD) as per manufacturer's instructions. Bisulfite converted DNA was used to amplify promoter regions of the IL-4 gene by PCR, using the primers in Table I . PCR products were subjected to pyrosequencing using the Pyromark Q24 Pyrosequencing system (Qiagen, MD) using the sequencing primers for CpG-408 and CpG-393 in Table I . Bisulfite converted DNA was also used to amplify promoter regions of the IFN-γ and Foxp3 genes by PCR and PCR products were then subjected to pyrosequencing using sequencing primers. Primers, which are listed in Table EI , were chosen based on previous studies.(26 (link);42 (link)) Methylation levels of PCR products at each CpG site were determined using PyroMark 24 run software (Qiagen,MD)
Pyromarkq24 pyrosequencing system
Manufactured by Qiagen
Sourced in United States
The PyroMarkQ24 is a pyrosequencing system designed for targeted DNA analysis. It utilizes a sequencing-by-synthesis approach to generate sequence data from DNA samples. The system provides reliable and reproducible results for applications such as SNP analysis, methylation profiling, and allele quantification.
Automatically generated - may contain errors
Lab products found in correlation
Epitect plus dna bisulfite kit, by Qiagen (4 mentions)
Pyromark gold q96 reagent, by Qiagen (3 mentions)
Pyromark pcr kit, by Qiagen (3 mentions)
Pyromark gold q24 reagent, by Qiagen (3 mentions)
Pyromark 24 run software, by Qiagen (2 mentions)
Dneasy blood tissue kit, by Qiagen (1 mentions)
Pyromark q24 2, by Qiagen (1 mentions)
Streptavidin sepharose high performance, by GE Healthcare (1 mentions)
Pyromark q24 vacuum workstation, by Qiagen (1 mentions)
Pyromark q24 plate, by Qiagen (1 mentions)
Pyromark q24 v2, by Qiagen (1 mentions)
Puregene blood core kit, by Qiagen (1 mentions)
Gentra puregene tissue kit, by Qiagen (1 mentions)
Qiaamp dna ffpe tissue kit, by Qiagen (1 mentions)
10 protocols using pyromarkq24 pyrosequencing system
1
Quantification of DNA Methylation
2
Bisulfite-based DNA Methylation Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was treated with bisulfite and amplified. The human CYP11B2 promoter regions spanning from −290 to +11 (CpG1 to CpG3) or from −278 to +69 (CpG‐2 to CpG3) were amplified using specific primers (Table 1 ). The CpG sites of rat CYP11B2 promoter regions are shown in Figure 1 . Each site was amplified using specific primers (Table 1 ). Ten PCR product clones generated using DNA from each sample (CpG1‐3, 5, 6, 8) were picked to analyze DNA methylation status, as we previously described.10 Methylation analysis (CpG 4, 7, 9, 10) by pyrosequencing was performed with PyroMarkGold Q96 Reagents and the PyroMarkQ24 pyrosequencing system (Qiagen, Hilden, Germany).
3
Evaluating FoxP3 Methylation Patterns
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Considering the influence of gender on methylation patterns due to X-chromosome inactivation,40 (link) DNA from male subjects were used for studying foxp3 methylation difference among various culture conditions. The DNA methylation status of the foxp3 gene promoter was assessed by pyrosequencing of bisulfite converted DNA. Genomic DNA was isolated from PBMCs cultured with or without SF-F2 in the presence or absence of Dex and bisulfite converted using Epitect Plus DNA Bisulfite Kit (Qiagen, MD), followed by PCR amplification of the foxp3 gene promoter. Five CpG residues (−138, −126, −113, −77, −65) relative to the transcriptional start site of the foxp3 gene were chosen, and schematic representation of the foxp3 gene and the 5 CpG sites in the promoter region was shown in Supplementary Figure 1 Supplementary Table 1
4
Quantitative Methylation Analysis of ADAM23
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The ADAM23 promoter methylation level was measured by the quantitative pyrosequencing method as published elsewhere.43 In brief, the region of interest was amplified from bisulfite‐modified DNA using amplification primers (Forward Biotin‐GCGTCGTTTTAGTATTTTTAGGTT; Reverse TCCCCAACCACTACTCCCT) and PyroMark PCR kit (Qiagen). After purification and denaturation, the biotinylated PCR product (89 bp) was sequenced (Pyrosequencing primer: ACTACTCCCTCCCCC) by Pyromark Q24 Pyrosequencing System (Qiagen). Obtained raw data were analyzed using PyroMark Q24 2.0.6 software (Qiagen). The results are presented as percentage of average methylation in eight CpG sites. The cut‐off for ADAM23 hypermethylation (9.53%) was established in our previous study as the mean methylation level determined in normal mammary glands plus 2 SD.39
5
Pyrosequencing Methylation Analysis Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A volume of 20 μl of each PCR product was mixed with 2 μl Streptavidin Sepharose High Performance (GE Healthcare, Uppsala, Sweden), 38 μl of PyroMark binding buffer and 10 μl water. The PyroMark Q24 Vacuum Workstation (Qiagen) was used to prepare single-stranded DNA. The Sepharose beads with the single-stranded templates attached were released into a PyroMark Q24 Plate (Qiagen) containing 25 μl of 0.3 μM corresponding sequencing primer in annealing buffer. Pyrosequencing reactions were carried out using the PyroMark Gold Q24 Reagents (Qiagen) in a PyroMark Q24 Pyrosequencing System (Qiagen) according to the manufacturer's protocol. The sequences of the pyrosequencing primers are listed in Supporting Information Table 1 . Quantification of CpG methylation was performed using the software PyroMark Q24 v.2.0.6 (Qiagen). The moderate amplification bias towards unmethylated alleles was corrected using the calibration data derived from a set of control samples and cubic polynomial regression as previously described [12 (link)].
6
Pyrosequencing Analysis of DNA Methylation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The percentages of methylated CpG sites in the target sequences of Dlx4, Dmrt1, Plcb4, and Reps1 were measured with bisulfite-converted DNA using the PyroMark Q24 pyrosequencing system (Qiagen) with the DNA samples isolated from the 0 ppm controls and the 100-ppm HCP-exposed group on PND 21 and PND 77. The isolated genomic DNA was bisulfite converted with an EpiTect® Plus DNA Bisulfite kit (Qiagen) and then used as a template (10 ng) for biotin PCR reactions utilizing a Qiagen PyroMark PCR kit under the following conditions: 95°C for 15 min, (94°C for 30 s, 56°C for 30 s, and 72°C for 30 s) × 45 cycles, and 72°C for 10 min. The sequencing reactions were performed using PyroMark Gold Q24 reagents (Qiagen). Specific pyrosequencing primers were designed to amplify CpG sites using Pyrosequencing Assay Design software Ver. 2.0 (Supplementary Table 3 ; Qiagen).
7
Quantitative DNA Methylation Analysis of CYP11B1 Promoter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from CPA, AUAT, normal ZF, and NFT flash-frozen (CPA n = 12, AUAT n = 12, normal ZF n = 4, NFT n = 4) or formalin-fixed paraffin-embedded tissue (CPA of Case 10, AUAT of Case 12, 3 normal ZF, and 3 NFT which could not be obtained as flash-frozen) using Gentra Puregene Tissue Kit (Qiagen, Hilden, Germany). We collected normal ZF samples from normal adrenal cortex with flash-frozen (n = 4) or formalin-fixed paraffin-embedded tissue (n = 3). The specimens from seven patients with NFT (n = 4), renal cell carcinoma (n = 1), and extra-adrenal paraganglioma (n = 2) were examined. We scraped the normal ZF area to extract DNA as previously reported28 (link). Genomic DNA from WBC was extracted using Puregene Blood Core Kit (Qiagen). Genomic DNA from samples was treated with bisulfite and PCR amplified with primers specific for human CYP11B1 promoter regions (Table S1 ). Quantitative methylation analysis of the PCR products was performed with PyroMarkGold Q96 Reagents and the PyroMarkQ24 pyrosequencing system (Qiagen).
8
Mutation Analysis of RAS and PIK3CA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mutation analysis of RAS and PIK3CA genes was performed using genomic DNA extracted from formalin-fixed, paraffin-embedded tissue sections (QIAamp DNA FFPE Tissue Kit, Qiagen, Carlsbad, CA, USA) and pyrosequencing performed by the Perth node of the Australian Genome Research Facility (AGRF) using the PyroMark Q24 Pyrosequencing system (Qiagen). The sensitivity for this platform is 2% mutant to WT alleles; a cutoff of 10% was used to call mutations based on prior recommendations for pyrosequencing. Full details are described in Supplementary File online. Variant sequences were confirmed by Sanger sequencing using both forward and reverse primers (AGRF).
9
Quantifying DNA Methylation in HSD11B1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA (500 ng) was treated with bisulfite and amplified. The human HSD11B1 promoter region was amplified using specific primers according to a previous report (Table 1) [9] . The CpG sites within the HSD11B1 promoter region are shown in Fig. 1. Bisulfite sequencing was performed using the Methylation DNA Modification Kit (EPIGENTEK, NY, USA) with specific primers (Table 1). Eight PCR product clones generated from the DNA of each sample were picked to analyze the DNA methylation status, as we described previously [25] . Methylation analysis by pyrosequencing was also performed using PyroMarkGold Q96 Reagents and the PyroMarkQ24 pyrosequencing system (Qiagen, NJ, USA) [24] .
10
Methylation analysis of target genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The percentages of methylated CpG sites in the target sequences of Edc4, Kiss1 and Mrpl38 were measured with bisulfite-converted DNA using the PyroMark Q24 pyrosequencing system (Qiagen) with the DNA samples isolated from the 0-ppm controls and the 1200-ppm IDPNexposed group on PND 21 and PND 77. The isolated genomic DNA (n = 4/group) was bisulfite converted with an EpiTect ® Plus DNA Bisulfite kit (Qiagen) and then used as a template (10-20 ng) for biotin PCR reactions utilizing a Qiagen PyroMark PCR kit under the following conditions: 95°C for 15 min, (94°C for 30 sec, 56°C for 30 sec, and 72°C for 30 sec) × 45 cycles, and 72°C for 10 min. The sequencing reactions were performed using PyroMark Gold Q24 reagents (Qiagen). Specific pyrosequencing primers were designed to amplify CpG sites, which are distributed within multiple CpG islands (CpG observed/expected > 0.6) in promoter regions of target gene, using Pyrosequencing Assay Design software Ver. 3; Qiagen).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!