Ptc 225

Manufactured by Bio-Rad

Sourced in United States

The PTC-225 is a programmable thermal cycler designed for high-throughput DNA amplification. It features a compact and efficient design, providing consistent and reliable temperature control for a wide range of PCR applications.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

PTC-225 Peltier Thermal Cycler (17 citations) PTC-225 Thermal Cycler (10 citations) PTC-225 thermocycler (5 citations) PTC-225 machine (3 citations) PTC-225 DNA Engine Tetrad Peltier (2 citations) Model PTC-225 (2 citations) PTC-225 DNA Engine (2 citations)

12 protocols using ptc 225

Quantifying gene expression using RT-qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were seeded either at 60,000 cells/well in 48-well plates or at 480,000 cells/well in 6-well plates. Prior to cell seeding, plates were coated with respective control siRNA (Silencer Select Negative Control, 4390843), GFPT2 target siRNAs (Silencer Select siGFPT2, s19305 and s19306), GSK3B target siRNAs (Silencer Select siGSK3B, s6239 and s6241), and RELA target siRNAs (Silencer Select siRELA, s11914 and s11915) as well as Lipofectamine RNAiMAX Transfection Reagent (Thermo). Cells were transfected at 37 °C and 5% CO₂ for 48 h with a final siRNA concentration of 10 nM.
In the RT-qPCR experiments, cells were mainly cultured in 48-well plates for 72 h, followed by total RNA extraction with TRI Reagent Solution (Invitrogen). RNA concentration was determined in NanoDrop One (Thermo). In total, 1000 ng of RNA was used for cDNA synthesis on the thermal cycler (MJ research, PTC-225, Peltier Thermal Cycler) using High-Capacity cDNA Reverse Transcription Kit (Thermo). Gene expression was measured with SYBR Green (Luna Universal qPCR Master Mix, NEW ENGLAND BioLabs) on Bio-Rad CFX384 Touch Real-Time PCR Detection System (Bio-Rad). Primers were selected either based on literature or from PrimerBank or designed on Primer3Plus website. Primer sequences for genes in this study (TAG Copenhagen) were listed in supplemental Table S1. The VIM primers were from IDT (Hs.PT.58.38906895).

Wang Q., Karvelsson S.T., Kotronoulas A., Gudjonsson T., Halldorsson S, & Rolfsson O. (2021). Glutamine-Fructose-6-Phosphate Transaminase 2 (GFPT2) Is Upregulated in Breast Epithelial–Mesenchymal Transition and Responds to Oxidative Stress. Molecular & Cellular Proteomics : MCP, 21(2), 100185.

+ Open protocol

+ Expand

CTLA4 Genetic Variant Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

The genomic DNA was extracted from peripheral blood leukocytes using a standardized salting-out procedure. The six variants in CTLA4 (rs1863800, rs733618, rs4553808, rs5742909, rs231775, rs3087243) were identified following polymerase chain reaction based restriction fragment length polymorphism (PCR-RFLP). Briefly, genomic DNA was amplified by PCR in PTC-225 (MJ RESEARCH, USA), using designed primers. Optimum PCR amplification was achieved with 1×PCR buffer, 2 mM MgCl2, 0.15 µM of each primer, 0.2 mM dNTP, 1.0 Unit Taq polymerase and 20 ng genomic DNA. (Table S1). The accuracy of genotyping has been further confirmed by Sanger's sequencing in 30 randomly selected cases.

Sun L., Meng Y., Xie Y., Zhang H., Zhang Z., Wang X., Jiang B., Li W., Li Y, & Yang Z. (2014). CTLA4 Variants and Haplotype Contribute Genetic Susceptibility to Myasthenia Gravis in Northern Chinese Population. PLoS ONE, 9(7), e101986.

+ Open protocol

+ Expand

Sanger Sequencing for Variant Confirmation

Check if the same lab product or an alternative is used in the 5 most similar protocols

The CYBC1 p.Tyr2Ter mutation was submitted to Sanger sequencing for confirmation of a homozygous genotype in the eight individuals detected by WGS and chip-genotyping. The position of the p.Tyr2Ter mutation was also sequenced by the Sanger method in the five family members of the two probands (Fig. 1a). The CYBA p.Arg90Trp mutation was also submitted to Sanger sequencing for all eight CYBC1 p.Tyr2Ter homozygous individuals. Primers for Sanger sequencing were designed using the Primer 3 software^{56 (link)}. Following PCR, cycle sequencing reactions were performed in both directions on MJ Research PTC-225 thermal cyclers, using the BigDye Terminator Cycle Sequencing Kit v3.1 (Life Technologies) and Ampure XP and CleanSeq kits (Agencourt) for cleanup of the PCR products and cycle sequencing reactions. Sequencing products were loaded onto the 3730 XL DNA Analyzer (Applied Biosystems) and analyzed with the Sequencher 5.0 software (GeneCodes Corporation).

Arnadottir G.A., Norddahl G.L., Gudmundsdottir S., Agustsdottir A.B., Sigurdsson S., Jensson B.O., Bjarnadottir K., Theodors F., Benonisdottir S., Ivarsdottir E.V., Oddsson A., Kristjansson R.P., Sulem G., Alexandersson K.F., Juliusdottir T., Gudmundsson K.R., Saemundsdottir J., Jonasdottir A., Jonasdottir A., Sigurdsson A., Manzanillo P., Gudjonsson S.A., Thorisson G.A., Magnusson O.T., Masson G., Orvar K.B., Holm H., Bjornsson S., Arngrimsson R., Gudbjartsson D.F., Thorsteinsdottir U., Jonsdottir I., Haraldsson A., Sulem P, & Stefansson K. (2018). A homozygous loss-of-function mutation leading to CYBC1 deficiency causes chronic granulomatous disease. Nature Communications, 9, 4447.

+ Open protocol

+ Expand

Fungal Diversity Profiling from Root Tips

Check if the same lab product or an alternative is used in the 5 most similar protocols

EMF root tips were rinsed with distilled water to remove excess RNAlater and then were lyophilized. Root tips were ground in lysis buffer with a motorized sterile pestle (Kontes, Rockwood, TN, USA). DNA was extracted from each root tip using the DNEasy Plant Mini Kit (QIAGEN Inc., Valencia, CA, USA) according to the manufacturer’s instructions with minor modifications suggested in Bent & Taylor (2010) (link). Genomic DNA was amplified in 25 µl PCR reactions containing 25 mM MgCl2, 10 mM dNTPs, 50 µM forward primer ITS1-F (CTTGGTCATTTAGAGGAAGTAA (Gardes & Bruns, 1993 (link))), 50 µM reverse primer ITS4 (TCCTCCGCTTATTGATATGC (White et al., 1990 )), 10 mg/ml bovine serum albumin, Promega Go-Taq (Sigma-Aldrich, St. Louis, MO, USA), 5X Promega Green Taq buffer, and 5 µl of genomic DNA. Reaction mixes were prepared in 0.2 ml tubes and thermocycled in an MJ Research PTC-225 thermal cycler as follows: 96 °C for 3 min, 35 cycles of 94 °C for 30 s, 52 °C for 30 s, then 72 °C for 3 min, followed by 72 °C for 10 min. PCR products were gel checked and Sanger sequenced by Functional Biosciences (Madison, WI).

Hewitt R.E., Taylor D.L., Hollingsworth T.N., Anderson C.B, & Martínez Pastur G. (2018). Variable retention harvesting influences belowground plant-fungal interactions of Nothofagus pumilio seedlings in forests of southern Patagonia. PeerJ, 6, e5008.

+ Open protocol

+ Expand

MCF-7 Cell Treatments and Transcriptional Profiles

Check if the same lab product or an alternative is used in the 5 most similar protocols

The MCF-7 cells were treated with with various treatments (G1; control, G2; doxorubicin at 0.55 µg/mL, G3; damnacanthal at 2.5 µg/mL, G4; damnacanthal at 8.2 µg/mL, G5; doxorubicin at 0.4 µg/mL and damnacanthal at 2.5 µg/mL and G6; doxorubicin at 0.2 µg/mL and damnacanthal at 8.2 µg/mL). Meanwhile untreated (G1) was used as controls. The expression profiles were analyzed at two time points, 12 and 24 h. After the treatment period, cells were trypsinized and washed twice with PBS in order to prepare for RNA extraction. Total RNA was extracted from the treated and untreated cell lines for both time points using the RNeasy® Mini Kits (Qiagen, Valencia, CA, USA). The eluted RNA was kept in −80 °C for future use. After RNA extraction and quantification, RNA from each sample was reverse transcribed to cDNA using the GenomeLab™ GeXP Start Kit (Beckman Coulter, Brea, CA, USA). The RT reaction then was run in a thermal-cycler (PTC-225, MJ Research, Watertown, MA, USA) with the following program: 48 °C for 1 min; 37 °C for 5 min; 42 °C for 60 min; 95 °C for 5 min; hold at 4 °C.

Aziz M.Y., Abu N., Yeap S.K., Ho W.Y., Omar A.R., Ismail N.H., Ahmad S., Pirozyan M.R., Akhtar N.M, & Alitheen N.B. (2016). Combinatorial Cytotoxic Effects of Damnacanthal and Doxorubicin against Human Breast Cancer MCF-7 Cells in Vitro. Molecules, 21(9), 1228.

+ Open protocol

+ Expand

ITS2 Amplification and Sequencing Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

The internal transcribed spacer 2 (ITS2) part of the nuclear ribosomal DNA was amplified with the primer pair ITS2/ITS4 according to White, Bruns, Lee and Taylor (1990) on a PTC-225 (Peltier Thermal Cycler, MJ Research, Waltham, MA, USA). PCR amplicons were purified with ExoSap IT (GE healthcare, Buckinghamshire, UK) according to the manufacturer’s procedure and visualized on standard agarose gel to ensure the presence of single-band products. Both strands of the PCR amplicons were sequenced with the PCR primers using DYEnamic ET dye terminator chemistry (Amersham Biosciences, Chicago, IL, USA), purified on AutoSeq96 (Amersham Biosciences) plates, diluted with 10 µL of MQ-water and subsequently analyzed on a MegaBace 1000 (Amersham Biosciences). Sequences were analyzed in Vector NTI Advanced 11 (Invitrogen, Waltham, MA, USA) and assembled in BioEdit 7.0.9.0 [29 ].

Elameen A., Stueland S., Kristensen R., Fristad R.F., Vrålstad T, & Skaar I. (2021). Genetic Analyses of Saprolegnia Strains Isolated from Salmonid Fish of Different Geographic Origin Document the Connection between Pathogenicity and Molecular Diversity. Journal of Fungi, 7(9), 713.

+ Open protocol

+ Expand

Genetic Identification of Biological Sex

Check if the same lab product or an alternative is used in the 5 most similar protocols

Polymerase chain reaction (PCR) based on sex determination was performed to identify the presence of sex region y gene (SRY) for males or alanine aminotransferase-1 gene (ALT1) for females. The sequences of primers for SRY were 5′-CATGAACGCATTCATCGTGTGGTC-3′, 5′-CTGCGGGAAGCAAACTGCAATTCT T-3′ and 5′-CCCTGATGAAGAACTTGTATCTC-3’, and 5′-GAAATTACACACATAGGTGGCACT-3′ for ATL1 (Settin et al., 2008 (link)). Each PCR reaction comprised 100 ng DNA, 1X PCR buffer minus Mg, 0.2 mM dNTP mixture, 1.5 nM MgCl2, 0.5 µM SRY and ALT1 primers (FWD and REV), and 2.5 units Taq DNA Polymerase (5 U/µl) (Invitrogen, Waltham MA, United States). All PCR reactions were performed in a thermal cycler (PTC-225, Peltier Thermal Cycler, MJ Research, NH, United States) at 94°C (3 min) for initial DNA denaturation, followed by 35 cycles of 94°C (15 s) for DNA denaturation, 55°C (30 s) for primer annealing and 72°C (90 s) for primer extension, with a final extension of the cycle at 72°C (10 min). The amplified PCR products were separated on a 2.5% agarose gel with ethidium bromide and imaged under UV transillumination. The product size of SRY was 254 bp for the Y chromosome and ALT1 was 300 bp for the X chromosome. Two product bands at 254 bp and 300 bp identified male samples and one band at 300 bp female samples.

Saito Reis C.A., Ng P.K., Kurashima C.K., Padron J, & Kendal-Wright C.E. (2022). Fetal DNA Causes Sex-Specific Inflammation From Human Fetal Membranes. Frontiers in Physiology, 13, 901726.

+ Open protocol

+ Expand

Multiplex Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total ribonucleic acid (RNA) was extracted from the treated and untreated cells using the RNeasy^® Plus Mini Kit (Qiagen, Germany). Following extraction and quantification, RNA from each sample was reverse transcribed to cDNA using a GenomeLab™ gene expression profiler (GeXP) Start Kit (Beckman Coulter, USA) containing Kanamycin resistance (KAN^r) as an internal control, reverse transcription buffers and reverse transcriptase. It was then mixed with a gene-specific reverse primer mix, RNA and RNase-free water according to the manufacturer's instructions. The RT reaction was then run on a thermal cycler (MJ Research Peltier Thermal Cycler (PTC)-225) using the following program: 48°C for 1 min; 37°C for 5 min; 42°C for 60 min; 95°C for 5 min, hold at 4°C. The PCR mixture containing MgCl₂, 5x PCR Master Mix buffer (fluorescently labeled universal forward primer) and Thermo-Start^® DNA polymerase (Thermo Fisher Scientific, Pittsburgh, PA) was prepared at 4:4:0.7 with respect to the final volume of 8.7 μL for each sample. This mixture was then mixed well with 9.3 μL of cDNA from each sample and 2 μL of a 200 nM multiplex of gene-specific forward universal primers. The final PCR was performed in an MJ Research PTC-225 thermal cycler starting at 95°C for 10 min, followed by 35 cycles of 94°C for 30 s, 55°C for 30 s, 68°C for 1 min and holding at 4°C.

Goh S.H., Alitheen N.B., Yusoff F.M., Yap S.K, & Loh S.P. (2014). Crude ethyl acetate extract of marine microalga, Chaetoceros calcitrans, induces Apoptosis in MDA-MB-231 breast cancer cells. Pharmacognosy Magazine, 10(37), 1-8.

+ Open protocol

+ Expand

Genomic DNA Isolation and Genotyping

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA was isolated from peripheral blood leukocytes with QIAamp DNA Blood Maxi kits (Qiagen, United States). Genotyping was performed by TaqMan assays (Applied Biosystems, United States) using 10 ng of template DNA in a 5 µL reaction. When available, pre-designed assays were employed. When pre-designed assays were unavailable, custom assays were designed using the manufacturer’s software. The thermal cycling conditions in the 384-well thermocycler (PTC-225, MJ Research) consisted of an initial hold at 95 °C for 10 min, followed by 40 cycles of a 15-s 95 °C denaturation step and a 1-min 60 °C annealing and extension step. Plates were read in the 7900HT Fast Real-Time PCR System (Applied Biosystems, United States). Data cleaning and quality control checks were performed using PLINK v1.9^{63 (link)} [www.cog-genomics.org/plink/1.9/] and PLINK v2.0^{64 (link)} [http://www.cog-genomics.org/plink/2.0/]. Heterogeneity between subjects recruited in Utah and Iowa were assessed using Cochran’s Q-statistic^{65 (link)} and the I² metric^{66 (link)} while adjusting for age and sex. We found no evidence of heterogeneity when considering SNPs and haplotypes in the CFH-CFHR5 region (

I^{2} = 0 %, p > 0.47

). The Utah and Iowa cohorts were therefore combined without resorting to meta-analyses for all associations analyses.

Zouache M.A., Richards B.T., Pappas C.M., Anstadt R.A., Liu J., Corsetti T., Matthews S., Seager N.A., Schmitz-Valckenberg S., Fleckenstein M., Hubbard W.C., Thomas J., Hageman J.L., Williams B.L, & Hageman G.S. (2024). Levels of complement factor H-related 4 protein do not influence susceptibility to age-related macular degeneration or its course of progression. Nature Communications, 15, 443.

+ Open protocol

+ Expand

Genotyping of Peripheral Blood Leukocytes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA was isolated from peripheral blood leukocytes with QIAamp DNA Blood Maxi kits (Qiagen, United States). Genotyping was performed by TaqMan assays (Applied Biosystems, United States) using 10 ng of template DNA in a 5 µL reaction. When available, predesigned assays were used. When predesigned assays were unavailable, custom assays were designed using the manufacturer's software. The thermal cycling conditions in the 384-well thermocycler (PTC-225; MJ Research) consisted of an initial hold at 95°C for 10 minutes, followed by 40 cycles of a 15-second 95°C denaturation step and a 1-minute 60°C annealing and extension step. Plates were read in the 7900HT Fast Real-Time PCR System (Applied Biosystems, United States). Data cleaning and quality control checks were performed using PLINK (version 1.9 and version 2.0).²³ (link)^,²⁴ (link)

Williams B.L., Zouache M.A., Seager N.A., Pappas C.M., Liu J., Anstadt R.A., Hubbard W.C., Thomas J., Hageman J.L., Mohler J., Richards B.T, & Hageman G.S. (2024). Levels of the HtrA1 Protein in Serum and Vitreous Humor Are Independent of Genetic Risk for Age-Related Macular Degeneration at the 10q26 Locus. Investigative Ophthalmology & Visual Science, 65(4), 34.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!