Hs d1000 screentape

Hemo KlenTaq (NEB) and dATP (A), dGTP (G), dTTP (T), and methylated dCTP (5mC) were used for filling in 5′ protruding ends of double-stranded DNA molecules, forming blunt-end molecules. 3′ A-tailing on blunt ends was processed by Hemo KlenTaq. The end-repaired DNA was subjected to DNA purification using a MinElute Reaction Cleanup kit (QIAGEN). We further applied polynucleotide kinase (PNK) (NEB) for 5′ phosphorylation of purified DNA, followed by methylated adapter ligation by T4 DNA ligase (NEB), obtaining the resultant DNA libraries ready for sequencing. All methylated adapters were TruSeq single indexed adapter (Illumina). The molecules with 3′ protruding ends were not able to be ligated with sequencing adapters, thus would not be present in the sequencing results.
We treated the adapter-ligated DNA with two rounds of bisulfite conversion by EpiTect Plus DNA Bisulfite kit (Qiagen). We amplified bisulfite-converted DNA molecules with 12 cycles using KAPA HiFi HotStart Uracil + ReadyMix (Roche). PCR primers included P5 PCR Primer (5′ AATGATACGGCGACCACCGAG) and P7 PCR Primer (5′ CAAGCAGAAGACGGCATACGAG).
We examined the quality of DNA library and the size of DNA by an Agilent 4200 TapeStation with HSD1000 ScreenTape (Agilent). The DNA libraries were sequenced on a NextSeq platform (Illumina) using the paired-end mode (75-bp × 2).

Starting with 500 ng of total RNA, cDNA library templates were synthesized using the Illumina TruSeq® Stranded Total RNA LT (Set A) Kit with Ribo-Zero Globin rRNA reduction, as described in the TruSeq® Stranded Total RNA Sample Preparation Guide (Rev. E., October 2013). Libraries were validated using the HS D1000 ScreenTape on the Agilent 2200 TapeStation and quantified on the Qubit® 2.0 Fluorometer by the Qubit® dsDNA HS Assay (ThermoFisher). The Illumina HiSeq2500 instrument was used to cluster the samples onto the flow cell. The pools were put on at 10 pM and run in rapid mode at 2 × 100 paired end. The Illumina HiSeq Rapid PE Cluster Kit V2 and HiSeq Rapid SBS Kit v2 200 cycles were used.

After visualization on the agarose gel, the LR-PCR fragments obtained were purified with Exo-Sap (Affymetrix, Santa Clara, USA) before they were quantified using Qubit dsDNA BR Assay System (Invitrogen, Carlsbad, USA) on the Qubit® 2.0 Fluorometer (Thermo Fisher, Waltham, USA).
In the next step, 27 amplicons of each patient were pooled in equimolar ratios. According to the manufacturer’s protocol, 1 ng of the pooled DNA fragments was subjected to the Nextera XT procedure (Illumina) using transposome technology. Finally, using Nextera XT DNA Sample Preparation Kit (Illumina) and Nextera^® XT Index Kit (96) (Illumina), we obtained eighty-seven both-side indexed DNA libraries ready for high-throughput sequencing. Quality control of the libraries was performed on TapeStation 2200 Instrument (Agilent, Santa Clara, USA) using an HS D1000 ScreenTape (Agilent). Normalization of all libraries was carried out with magnetic beads, according to the Nextera XT procedure.