Pcmv myc3 hdm2

A375 cells seeded in 6-well plates were co-transfected with pcDNA-Flag-p53 (Addgene) and pCMV-myc3-hDM2 (Addgene) for 6 h using TurboFect transfection reagent following the instruction from manufacturer. Cells were then cultured in Dulbecco's Modified Eagle's Medium (DMEM) complete medium overnight. Serial dilutions of organometallic compounds in low FBS buffer were placed into the wells, and incubated with cells for additional 6 h. Protein samples were collected, and the concentration in the supernatant was determined with the bicinchoninic acid (BCA) method. The organometallic compounds of p53/hDM2 in the protein samples were pulled down using anti-Flag magnetic beads to capture the FLAG fusion proteins (Sigma) as previously described [50 , 51 (link)]. The protein-binding beads were washed three time with TBS buffer (50 mM Tris HCl, 150 mM NaCl, pH 7.4) to remove non-specifically bound proteins, and subsequently subjected to the sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) by detection with anti-Flag (1:1000, Sigma-Aldrich) and anti-myc antibodies (1:1000, Beyotime).

pCMV-myc3-HDM2 (Addgene Plasmid #20935) was a gift from Yue Xiong, pcDNA3 flag p53 (Addgene plasmid # 10838) was a gift from Thomas Roberts, HA-tagged ubiquitin plasmids (WT, K48, and K63) were gift from Ted Dawson [16 (link)]. LentiCRISPRv2 was a gift from Feng Zhang (Addgene plasmid # 52961), and sgRNA specificly targeting human MYL6B (6Bsg1: ACTTTGGAGAGATCGACTGG; 6Bsg2: TTATACTTTAGAGTTCAAGG and 6Bsg3: TTCCCGTGAAGAAACCAGCA) were cloned into LentiCRISPRv2 following provider’s guide. Myc-DDK-tagged Human MYL6B ORF sequence was cloned into pCMV6 (OriGene). 3FLAG-tagged MYL6B ORF sequence was cloned into pcDNA3. Rabbit polyclone antibodies anti-p53, anti-Bax, anti-MYL6B, anti-MDM2 and mouse monoclone antibody anti-GAPDH were from Proteintech Inc. Rabbit polyclone antibody anti-ubiquitin were from Dako. Mouse monoclone anti-FLAG M2, anti-FLAG M2 Affinity Agarose Gel, and anti-c-Myc Affinity Agarose Gel was from Sigma-Aldrich.