Clonexpress ultra one step cloning kit c115

The overexpression vector pSET152 which mainly contains a constitutive promoter ermE*, site-specific recombinant elements phage φC31 integrase and the attachment site attP gene, resistant acc3(IV) apramycin gene as selection markers was digested with restriction endonuclease BamHI. The SCrp gene was PCR-amplified (from genomic DNA of the wild-type strain Streptomyces sp. XS-16) using specific primers SCrp-F/R (Table S1). The PCR products SCrp gene was introduced into pSET152 vector to generate pSET152-SCrp using the ClonExpress Ultra One Step Cloning Kit C115 (Vazyme) (Figure S3). The recombinant vector was transformed into competent E. coli strain DH5α to extract plasmids for transformation.

A short hairpin RNAs pair which targets Tfeb was cloned into pLVX-shRNA2 plasmid (Clontech Laboratories, Inc. 632179) with BamH I and EcoR I according to the protocol of ClonExpress^® Ultra One Step Cloning Kit (C115) purchased from Vazyme, and the shRNA sequence as follow, forward: 5′-GATC CGGCAGTACTATGACTATGATTTCAAGAGAATCATAGTCA TAGTACTGCCGTTTTTG-3′, reverse: 5′-AATTCAAAAACGG CAGTACTATGACTATGATTCTCTTGAAATCATAGTCATAG TACTGCCG-3′. For producing lentiviral particles, the vector and packaging plasmids were transfected into 293T cells about 36 h and harvested the supernatant which contained lentivirus. Using these virus particles to transfect BMDMs to knock down Tfeb.