Qiaamp dna investigator kit

Manufactured by Qiagen

Sourced in Germany, United States, Canada, United Kingdom

The QIAamp DNA Investigator Kit is a product designed for the purification of DNA from a variety of forensic and investigative samples. The kit utilizes a simple spin-column procedure to efficiently isolate high-quality DNA from small sample volumes.

Automatically generated - may contain errors

Lab products found in correlation

115 protocols using qiaamp dna investigator kit

Insect and Human DNA Extraction

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

After removing the puparium, DNA was extracted from the inner soft tissues of the pupae using the extraction method as described in Lehmann et al. [16 (link)] and following the manufacturer’s supplementary protocol “Purification of total DNA from insects using a disposable microtube pestle” of the DNeasy tissue kit (Qiagen). The DNA was eluted in 50 µl of Buffer AE.
The DNA from the volunteer was extracted from 10 µl of blood using QIAamp® DNA Investigator Kit (Qiagen), following the manufacturer’s protocol “Isolation of Total DNA from Small Volumes of Blood or Saliva” and eluted in 50 µl of buffer AE.
The DNA from all fly artifacts was extracted by QIAamp® DNA Investigator Kit (Qiagen) following the manufacturer’s protocols “Isolation of Total DNA from Surface and Buccal Swabs”, and the DNA was eluted in 25 µl of buffer ATE.
Negative controls were set up for all the extraction sessions.

Bini C., Giorgetti A., Iuvaro A., Giovannini E., Gianfreda D., Pelletti G, & Pelotti S. (2021). A DNA-based method for distinction of fly artifacts from human bloodstains. International Journal of Legal Medicine, 135(6), 2155-2161.

+ Open protocol

+ Expand

Comprehensive Nucleic Acid Extraction Methods

Check if the same lab product or an alternative is used in the 5 most similar protocols

Peripheral blood DNA was extracted using Gentra Purgene Blood Kit (Qiagen, Germantown, MD). DNA from urine was extracted 24 hours after collection using the Quick‐DNA Urine Kit (Zymo Research, Irvine, CA). The prepIT‐L2P (DNA Genotek, Ottawa, Canada) reagent was used to isolate DNA from buccal cells and saliva. The QIAamp DNA Investigator Kit (Qiagen) was used to extract DNA from hair follicles and nail clippings from fingers and toes. All procedures were followed to the manufacturer's protocols.

Yıldız Bölükbaşı E., Karolak J.A., Szafranski P., Gambin T., Willard N., Abman S.H., Galambos C., Kinsella J.P, & Stankiewicz P. (2022). High‐level gonosomal mosaicism for a pathogenic non‐coding CNV deletion of the lung‐specific FOXF1 enhancer in an unaffected mother of an infant with ACDMPV. Molecular Genetics & Genomic Medicine, 10(11), e2062.

+ Open protocol

+ Expand

Genotyping of Human Buccal DNA

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Buccal DNA was extracted from collected samples using QIAamp® DNA Investigator kit (QIAGEN, Hilden, Germany), and quantified using Qubit™ 1X dsDNA HS Assay kit with Qubit™ Flex Fluorometer, according to the manufacturer’s instructions (Thermo Fisher Scientific, Waltham, MA, USA). The genotyping was performed using Affymetrix™ Axiom KORV1.1-96 Array comprising > 827 K SNPs (Affymetrix), according to the manufacturer’s instructions (Thermo Fisher Scientific). Raw SNP data was filtered for quality control (QC) using PLINK v1.9 and SNPolisher (Purcell et al. 2007 (link)), with the criteria of SNPs with call rate > 0.95, Hardy − Weinberg equilibrium p-value > 1 × 10^− 4, and minor allele frequency (MAF) cutoffs > 0.1. SNPs on sex chromosomes and duplicated SNPs were excluded. A total of 259,293 SNPs was selected for the subsequent analysis, and haplotypes of these SNPs were estimated using the ShapeIT algorithm (Delaneau et al. 2008 (link)). All experiments were performed in accordance with the relevant guidelines and regulations.

Cho S., Shin E., Park Y.G., Choi S.H., Choe E.K., Bae J.H., Lee J.E, & Lee S.D. (2024). A novel approach of kinship determination based on the physical length of genetically shared regions of chromosomes. Genes & Genomics, 46(5), 577-587.

+ Open protocol

+ Expand

DNA Isolation and 16S Amplicon Sequencing

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Individual discs were cut from the FTA cards using a sterile 5.0 mm single round hole punch and total DNA isolated using the QIAamp DNA Investigator Kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol. Quantification of DNA was carried out in duplicate using Quant-iT™ PicoGreen® dsDNA detection kit (Molecular Probes, Eugene OR). Amplification of the 16S ribosomal RNA (rRNA) gene amplifications and 16S gene amplicon sequencing for all DNA samples were performed at Centre d'expertise et de services Génome Québec (Montréal, QC, Canada) using the universal primers 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’)^{86 (link)}. Sequence libraries were prepared by Génome Québec with TruSeq® DNA Library Prep Kit (Illumina, San Diego, CA, USA) and quantified using KAPA Library Quantification Kit for Illumina platforms (Kapa Biosystems). Paired-end sequences were generated on a MiSeq platform PE300 (Illumina Corporation, San Diego, CA, USA) with the MiSeq Reagent Kit v3 600 cycles (Illumina, San Diego, CA, USA).

Ferchiou S., Caza F., Villemur R., Betoulle S, & St-Pierre Y. (2022). Species- and site-specific circulating bacterial DNA in Subantarctic sentinel mussels Aulacomya atra and Mytilus platensis. Scientific Reports, 12, 9547.

+ Open protocol

+ Expand

FFPE DNA Extraction and Repair

Check if the same lab product or an alternative is used in the 5 most similar protocols

FFPE blocks were retrieved from the corresponding Biobanks, and glass slides were prepared for hematoxylin and eosin staining to guide the macrodissection of the tumor. Either three unstained sections of 10 μm thick tissue were manually scraped, or three 0.6 mm needle biopsies were taken from every sample to ensure a high tumor content, depending on tumor cellularity below or above 70%, respectively.
DNA extraction was performed using the QIAamp^® DNA Investigator kit (QIAGEN, Hilden, Germany) with minor modifications. An overnight incubation step at 56 °C for the proteinase K was set to assure complete digestion of the skin, and an optional RNA carrier was added to maximize the extraction yield. Moreover, the NEBNext^® FFPE Repair Mix (New England Biolabs, Hertfordshire, UK) was used to repair the DNA, hence minimizing sequencing artifacts due to C:G > T:A changes induced by nucleotide deamination, usually present in FFPE samples. DNA concentration was quantified using the Quant-iT™ PicoGreen™ dsDNA (ThermoFisher, Waltham, MA, USA) fluorimetric assay, and those samples with >2.5 ng/uL continued the process.

Millán-Esteban D., Peña-Chilet M., García-Casado Z., Manrique-Silva E., Requena C., Bañuls J., López-Guerrero J.A., Rodríguez-Hernández A., Traves V., Dopazo J., Virós A., Kumar R, & Nagore E. (2021). Mutational Characterization of Cutaneous Melanoma Supports Divergent Pathways Model for Melanoma Development. Cancers, 13(20), 5219.

+ Open protocol

+ Expand

Extracting High-Quality DNA from Mouse Heart

Check if the same lab product or an alternative is used in the 5 most similar protocols

Snap-frozen mouse heart slices from −80°C were lysed in Buffer ATL and proteinase K at 56°C overnight on a thermomixer using TissueLyser (QIAamp DNA Investigator Kit, Qiagen). Total DNA (genomic + mitochondrial) was extracted from the tissue lysates using Quick-DNA Miniprep Kit (Zymo Research) according to manufacturer’s instruction. Before proceeding to qPCR, the DNA templates were subjected to shearing and reducing viscosity by passing them through 21G needles for >2 minutes, as described previously, (22 ) to avoid dilution bias. The template concentration was determined using NanoDrop and adjusted to 10 ng/μl. To avoid errors arising from repeated freeze thaw cycles, DNA samples were kept at 4°C for the duration of study.

Haileselassie B., Mukherjee R., Joshi A.U., Napier B.A., Massis L.M., Ostberg N.P., Queliconi B.B., Monack D., Bernstein D, & Mochly-Rosen D. (2019). Drp1/Fis1 Interaction Mediates Mitochondrial Dysfunction in Septic Cardiomyopathy. Journal of molecular and cellular cardiology, 130, 160-169.

+ Open protocol

+ Expand

DNA Extraction from Buccal Swab Duplicates

Check if the same lab product or an alternative is used in the 5 most similar protocols

A buccal swab was collected from Fides Kozulić in 2011 as a DNA reference of Sister Marija Kozulić, her paternal aunt. The buccal swab was cut into two halves using a sterile blade and placed in 1.7 mL tubes. DNA extraction was performed independently on each half of the swab on separate occasions using the QIAamp DNA Investigator kit (QIAGEN) following the manufacturer’s recommendations.

Marshall C., Sturk-Andreaggi K., Gorden E.M., Daniels-Higginbotham J., Sanchez S.G., Bašić Ž., Kružić I., Anđelinović Š., Bosnar A., Čoklo M., Petaros A., McMahon T.P., Primorac D, & Holland M.M. (2020). A Forensic Genomics Approach for the Identification of Sister Marija Crucifiksa Kozulić. Genes, 11(8), 938.

+ Open protocol

+ Expand

Quantitative Bacterial DNA Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols

Purification of DNA was performed using the QIAamp DNA Investigator Kit automated on the QIAcube apparatus (Qiagen) in accordance with the manufacturer's directions. The V1–V3 16S ribosomal RNA (rRNA) gene variable regions were amplified by PCR using 454 sequencing methods (Roche, Boulogne‐Billancourt, France), as described previously 14. Purified amplicon DNAs were sequenced on a 454 instrument using FLX titanium chemistry (GenoScreen, Lille, France) in accordance with the manufacturer's instructions. Sequence analysis was performed with GnS‐PIPE (Genosol, Dijon, France). The reads were assigned to operational taxonomic units using the SILVA database with USEARCH. Biodiversity was estimated by calculating the Shannon index (H′; accounts for abundance and evenness of species present in a community).
To quantify S. aureus and S. epidermidis, real‐time PCR was performed with absolute quantification analysis using a standard curve (ATCC 700699 for S. aureus, 12228 for S. epidermidis): S. aureus sodA: primers forward: GAGCATCAATCACTAGCGGA, reverse: ACCGCCATTATTACGGACTG, FAM‐probe: TGCTAACTTAGACAAGGTACCGG; S. epidermidis sodA: primers forward: TTTAGAAGCTAAATCAATCGAAGAAA, reverse: GGTGACCACCGCCATTATTA, FAM‐probe: TGCCATCTAATATTCAAACAGCTGT. Because sodA is present in a single copy number, the number of copies corresponds to the number of bacteria.

Bianchi P., Theunis J., Casas C., Villeneuve C., Patrizi A., Phulpin C., Bacquey A., Redoulès D., Mengeaud V, & Schmitt A. (2016). Effects of a New Emollient‐Based Treatment on Skin Microflora Balance and Barrier Function in Children with Mild Atopic Dermatitis. Pediatric Dermatology, 33(2), 165-171.

+ Open protocol

+ Expand

Extraction of Genomic DNA from Parasite Cultures and Dried Blood Spots

Check if the same lab product or an alternative is used in the 5 most similar protocols

gDNA was obtained from 3%–7% parasitemia cultures by lysing with 0.1% saponin in 1× PBS, and extracting with the QIAamp DNA Blood Midi Kit (Qiagen), with a combined RNase and Proteinase K treatment. DNA concentrations were determined using the Qubit dsDNA BR assay kit (Thermo Fisher Scientific). gDNA was extracted from both clinical (3 mm punches) and simulated DBSs (6 mm punches) using the QIAamp DNA Investigator kit (Qiagen) according to the manufacturer’s protocol, and eluted in 40 μl of AE buffer.

Kanai M., Yeo T., Asua V., Rosenthal P.J., Fidock D.A, & Mok S. (2022). Comparative Analysis of Plasmodium falciparum Genotyping via SNP Detection, Microsatellite Profiling, and Whole-Genome Sequencing. Antimicrobial Agents and Chemotherapy, 66(1), e01163-21.

+ Open protocol

+ Expand

Non-invasive DNA Extraction Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA extraction of non-invasive or minimally invasive samples (hairs, scats, saliva swabs) was conducted in a laboratory dedicated to processing of non-invasively collected sample material^{12 (link)}. The QIAamp Fast DNA Stool Mini Kit (Qiagen) for faecal samples and the QIAamp DNA Investigator Kit (Qiagen) for all other non-invasive sample types, respectively, were used to extract DNA on the QIAcube system (Qiagen) generally following manufacturer’s instructions with some adjustments (Supplementary Tables S8 – S10). DNA from invasive samples was extracted with the Blood&Tissue Kit (Qiagen) according to the manufacturer’s protocol. Nucleic acid concentrations of DNA extracts from invasive samples were measured with a Nanodrop spectrophotometer. Isolated DNA was stored at 4 °C until use.

Wehrenberg G., Tokarska M., Cocchiararo B, & Nowak C. (2024). A reduced SNP panel optimised for non-invasive genetic assessment of a genetically impoverished conservation icon, the European bison. Scientific Reports, 14, 1875.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!