Rabbit anti tbk1

Manufactured by Abcam

Sourced in United States

Rabbit anti-TBK1 is a primary antibody that specifically binds to the TBK1 (TANK-binding kinase 1) protein. TBK1 is a serine/threonine protein kinase that plays a role in immune and inflammatory signaling pathways. This antibody can be used in various immunoassays to detect and analyze the TBK1 protein.

Automatically generated - may contain errors

Lab products found in correlation

Rabbit anti phospho irf3, by Cell Signaling Technology (2 mentions) Rabbit anti irf3, by Cell Signaling Technology (2 mentions) Rabbit anti phospho tbk1, by Cell Signaling Technology (2 mentions) Mouse anti pcbp2, by Santa Cruz Biotechnology (2 mentions) Lsm 780, by Zeiss (2 mentions) Rabbit anti flag, by Merck Group (1 mentions) Mouse anti v5 antibody, by Immunoway (1 mentions) Duolink in situ pla, by Merck Group (1 mentions) Mouse anti irf3, by Cell Signaling Technology (1 mentions) Lsm 800 meta confocal microscope, by Zeiss (1 mentions) Mouse anti glucagon, by Merck Group (1 mentions) Guinea pig anti insulin, by Merck Group (1 mentions) Rabbit anti ki67, by Abcam (1 mentions) 4 6 diamidino 2 phenylindole (dapi), by Merck Group (1 mentions) Vectashield, by Vector Laboratories (1 mentions) Tissue tek oct compound, by Sakura Finetek (1 mentions) Control mouse igg, by Santa Cruz Biotechnology (1 mentions) Control rabbit igg, by Merck Group (1 mentions) Hrp conjugated goat anti mouse or rabbit igg, by Thermo Fisher Scientific (1 mentions) Anti ubiquitin, by Merck Group (1 mentions)

Close spelling variants of this product

Rabbit anti-TBK1 (ab40676, Anti-TBK1 Rabbit anti-

6 protocols using rabbit anti tbk1

Antibodies for Immune Signaling Pathway

Check if the same lab product or an alternative is used in the 5 most similar protocols

Rabbit anti-phospho-IRF3 (Cat# 4947, 1:1000), rabbit anti-IRF3 (Cat# 4302, 1:1000), rabbit anti-phospho-TBK1 (Cat# 5483, 1:1000) and rabbit anti-cGAS antibodies (Cat# 15102, Cat# 79978, Cat# 31659 (Mouse specific), 1:1000) were from Cell Signaling Technology. Rabbit anti-TBK1 (Cat# ab40676, 1:1000) was from Abcam. Rabbit anti-PCBP2 (Cat# 15070-1-AP, 1:1000) was from Proteintech. Mouse anti-PCBP2 (Cat# sc-101136, 1:1000) was from Santa Cruz Biotechnology. Mouse anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (Cat# KM9002, 1:4000), mouse anti-α-Tubulin (Cat# KM9007, 1:8000), and mouse anti-HA (Cat# KM8004, 1:1000) antibodies were from Sungene Biotechnology. Rabbit anti-Flag (Cat# F7425, 1:1000) antibody was from Sigma. Mouse anti-Flag (Cat# M185-3, 1:1000), rabbit anti-HA (Cat# M132-3, 1:1000), rabbit anti-Myc (Cat# 562, 1:1000), mouse anti-Myc (Cat# M192-3, 1:1000) antibodies were from MBL. Mouse anti-V5 antibody (Cat# YM3005, 1:1000) was from ImmunoWay Biotechnology Company. Rabbit anti-PCBP1 (Cat# A1044, 1:1000) antibody was from ABclonal Technology. Mouse/Rabbit anti-cGAS antibody was prepared in our laboratory, the cGAS antibody was generated by immunizing mice or rabbits with purified human cGAS full-length from E. coli.

Gu H., Yang J., Zhang J., Song Y., Zhang Y., Xu P., Zhu Y., Wang L., Zhang P., Li L., Chen D, & Sun Q. (2022). PCBP2 maintains antiviral signaling homeostasis by regulating cGAS enzymatic activity via antagonizing its condensation. Nature Communications, 13, 1564.

+ Open protocol

+ Expand

Detecting Endogenous IRF3-TBK1 Interaction

Check if the same lab product or an alternative is used in the 5 most similar protocols

Duolink in situ PLA (Sigma) was used to detect the endogenous association of IRF3 and TBK1 in cells. In brief, HepG2 cells plated on glass coverslips were transfected with EBOV minigenome plasmids. After fixation with 4% formaldehyde, the cells were permeabilized with 0.3% Triton X-100 in phosphate-buffered saline (PBS) for 15 min. After blocking with blocking buffer (Sigma, DUO82007), the cells were incubated with mouse anti-IRF3 (Cell Signaling Technology) and rabbit anti-TBK1 (Abcam) primary antibodies. The nuclei were stained with DAPI (blue). The red fluorescent spots generated from the DNA amplification-based reporter system combined with oligonucleotide-labeled secondary antibodies were detected with a Zeiss LSM 800 Meta confocal microscope (Carl Zeiss).

Zhu L., Jin J., Wang T., Hu Y., Liu H., Gao T., Dong Q., Jin Y., Li P., Liu Z., Huang Y., Liu X, & Cao C. (2024). Ebola virus sequesters IRF3 in viral inclusion bodies to evade host antiviral immunity. eLife, 12, RP88122.

+ Open protocol

+ Expand

Immunohistochemical Analysis of Pancreatic Islets

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Immunohistochemistry was performed as previously described^{45 (link)} using the following antibodies: mouse anti-Glucagon (1:100; Sigma), rabbit anti-TBK1 (1:100; Abcam), rabbit anti-IKKε (1:100; Abcam), rat anti-C-Peptide (1:300; DSHB), rabbit anti-PDE3B (1:100; Cell Signaling), rabbit anti-Ki67 (1:100; Abcam), guinea pig anti-Insulin (1:100; Sigma), and fluorescently conjugated Alexa antibodies (1:200; Molecular Probes). Nuclei were visualized with DAPI (1:2000; Sigma). Islet samples were directly imaged in plates on a Zeiss LSM 700-405 or LSM 780 confocal microscope. Mice pancreata were dissected, fixed in 4% PFA, treated with either 70% ethanol then embedded in paraffin or a 30% sucrose solution then embedded in Tissue-Tek OCT compound (Sakura Finetek). 8 μm-thick sections were obtained by using a cryostat microtome (CryoStar NX70 Cryostat), stained with antibodies, mounted in Vectashield (Vector Laboratories), and imaged on a Zeiss LSM 700-405 confocal microscope.

Jia Y.F., Jeeva S., Xu J., Heppelmann C.J., Jang J.S., Slama M.Q., Tapadar S., Oyelere A.K., Kang S.M., Matveyenko A.V., Peterson Q.P, & Shin C.H. (2020). TBK1 regulates regeneration of pancreatic β-cells. Scientific Reports, 10, 19374.

+ Open protocol

+ Expand

Antibodies and Nucleic Acid Probes for Immunoblotting

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mouse control IgG (Santa Cruz Biotechnology, sc-2025) and rabbit control IgG (Millipore, 12–370), HRP-conjugated goat-anti mouse or rabbit IgG (Thermo Scientific, PA1-86717 and SA1-9510) (1:3000), HRP-conjugated mouse anti-FLAG (Sigma, A8592)(1:1000), mouse anti-FLAG (Sungene, KM8002)(1:2000), anti-GFP (Sungene, KM8009)(1:2000) anti-β-Actin (KM9001)(1:2000), anti-Tubulin (KM9003), anti-GAPDH(KM9002), anti-HA (COVANCE, MMS-101R)(1:2000), anti-Ubiquitin (sc-8017)(1:500), anti-Ubiquitin K63-specific linkage (Millipore 05–1308)(1:500), rabbit anti-TBK1(Abcam, 96328–11), anti-p-TBK1(Abcam, 109272), anti-IRF3 (sc-9082)(1:1000), anti-p-IRF3 (Cell Singling Technologies, 4947S)(1:1000), anti-IκBα (sc-371)(1:1000), anti-p-IκBα (Cell Singling Technologies, 9246L)(1:1000), anti-USP49 (proteintech,18066-1-AP), anti-mouse MITA and anti-human MITA (Cell Singling Technologies,13647) (proteintech, 19851-1-AP) were purchased from the indicated manufactures. ISD45, DNA90, and HSV120 were previously described [44 (link), 45 (link), 72 (link), 73 (link)]. ISD45: 5’-TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA-3’; DNA90: 5’-TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACATACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA-3’; HSV120: 5’-AGACGGTATATTTTTGCGTTATCACTGTCCCGGATTGGACACGGTCTTGTGGGATAGGCATGCCCAGAAGGCATATTGGGTTAACCCCTTTTTATTTGTGGCGGGTTTTTTGGAGGACTT-3’.

Ye L., Zhang Q., Liuyu T., Xu Z., Zhang M.X., Luo M.H., Zeng W.B., Zhu Q., Lin D, & Zhong B. (2019). USP49 negatively regulates cellular antiviral responses via deconjugating K63-linked ubiquitination of MITA. PLoS Pathogens, 15(4), e1007680.

+ Open protocol

+ Expand

Investigating IFN-mediated Immune Responses

Check if the same lab product or an alternative is used in the 5 most similar protocols

Poly(I:C) (Invitrogen, Carlsbad, CA, USA), IFN-γ (Peprotech, Rocky Hill, NJ, USA), IFN-α (Peprotech), TRIzol Reagent (Takara, Dalian, China), Gamma Bind G Plus-Sepharose (Amersham Biosciences, GE Healthcare, Marlborough, MA, USA) and the human IFN-β ELISA kit (PBL, Piscataway, NJ, USA) were purchased from the indicated manufacturers. HEK293 and HeLa cells were obtained from the ATCC. Mouse anti-Flag (Sigma, St Louis, MO, USA), mouse anti-β-actin (Sigma), mouse anti-GFP (Santa Cruz Biotechnology, Santa Cruz, CA, USA), mouse anti-LMNB1 (Proteintech, Rosemont, IL, USA), rabbit anti-IRF3 (Santa Cruz Biotechnology), rabbit anti-pIRF3 (CST, Danfoss, MA, USA), rabbit anti-VISA (Bethyl, Montgomery, TX, USA), rabbit anti-TBK1 (Abcam, Cambridge, UK), rabbit anti-pTBK1 (Abcam) and rabbit anti-LC3 (Sigma) antibodies were purchased from the indicated manufacturers. Rabbit and mouse antibodies against IFITM3 were raised against recombinant human IFITM3.

Jiang L.Q., Xia T., Hu Y.H., Sun M.S., Yan S., Lei C.Q., Shu H.B., Guo J.H, & Liu Y. (2017). IFITM3 inhibits virus-triggered induction of type I interferon by mediating autophagosome-dependent degradation of IRF3. Cellular and Molecular Immunology, 15(9), 858-867.

+ Open protocol

+ Expand

Antibodies for Immunological Signaling Pathways

Check if the same lab product or an alternative is used in the 5 most similar protocols

Rabbit anti-phospho-IRF3, rabbit anti-IRF3, rabbit anti-phospho-TBK1 and rabbit anti-cGAS antibodies were from Cell Signaling Technology. Rabbit anti-TBK1 was from Abcam. Rabbit anti-PCBP2 was from Abcam and Proteintech. Mouse anti-PCBP2 was from Santa Cruz Biotechnology. Mouse anti-glyceraldehyde-3phosphate dehydrogenase (GAPDH), mouse anti-α-Tublin and mouse anti-HA antibodies were from Sungene Biotechnology. Rabbit anti-Flag antibody was from Sigma. Mouse anti-Flag, rabbit anti-HA, rabbit anti-Myc, mouse anti-Myc antibodies were from MBL. Mouse/rabbit anti-cGAS antibody was prepared in our laboratory, the cGAS antibody was generated by immunizing mice or rabbits with puri ed human cGAS full-length from E. coli.

Gu H., Yang J., Zhang J., Zhang P., Li L., Chen D., & Sun Q. (2021). PCBP2 maintains antiviral signaling homeostasis by regulating cGAS enzymatic activity via antagonizing its condensation.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!