Bamhi

The human BMI1 fragment was excised from the pBabe-hBMI1 vector (provided by Goberdhan P. Dimri) using the restriction enzyme EcoRI (Takara Bio Inc., Kusatsu, Japan) and inserted into the EcoRI site of the pMXs-puro backbone vector (Cell Biolabs Inc., San Diego, CA, USA). The human △NP63α fragment was excised from the deltaNp63alpha-FLAG expression vector (plasmid #26979; Addgene, Watertown, NY, USA) using the restriction enzymes BamHI (Takara Bio Inc.) and NotI (Takara Bio Inc.), and inserted into the BamHI and NotI site of the pMXs-puro backbone vector. The constructed plasmids were confirmed by sequencing.

The starting plasmids were obtained from the clinical isolates Escherichia coli 58–132 and NR390 maintained at the Nara Medical University Hospital (Kashihara, Nara, Japan). The bla_IMP-1 and bla_IMP-6 genes were amplified by PCR using primers IMP-6-full-F (5′-AGCAAGTTATCTGTATATATTTTTGTTTTG-3′) and IMP-6-mat-R-Bam (5′-ATATAGGATCCTTAGTGGTTTTGATGGTTT-3′). PCR products were digested with the restriction enzyme Bam HI (TaKaRa Bio, Shiga, Japan). A pET28a vector (Merck Millipore, Darmstadt, Germany) was digested with Nco I, blunted with a blunting kit (TaKaRa Bio, Shiga, Japan) and further digested with Bam HI. The vector and the inserts bla_IMP-6 and bla_IMP-1 were ligated using T4 ligase to generate the pET28a-imp6 and pET28a-imp1 plasmids, respectively. Escherichia coli BL21(DE3) cells were transformed with each plasmid.

Putative MYB cis‐element was identified in the promoter region of the ADC gene (Pbr022368.1) based on the pear genome sequence (http://peargenome.njau.edu.cn/). Yeast one‐hybrid assay was performed to investigate whether PbrMYB21 could interact with the MYB cis‐element. The full‐length ORF of PbrMYB21 was amplified by PCR using primers (GSP7, Table S1) and integrated into the BamHI and NcoI sites of pGADT7‐Rec (Clontech) to create a prey vector (pGADT7‐PbrMYB21). Based on the distribution of the MYB cis‐element, one fragment (P1, ‐673 to ‐668 bp) was PCR amplified using primers (GSP8, Table S1) containing SmaI and XhoI restriction sites (ADC‐P1) and cloned into the pAbAi vector to construct the bait. Both the effector vector and reporter vector were co‐transformed into yeast strain Y1H Gold following the manufacturer's instructions (Clontech). The transformed cells were spread on SD/‐Ura/‐Leu medium added with (0 or 300 ng/mL) AbA, and incubated for 3 days at 30 °C. Both positive (pGAD‐p53+ p53‐AbAi) and negative (pGADT7‐AD + P1) controls were included and processed in the same way.

The lentiviral vector was derived from pMSCV-ffLuc-pIRES2-Thy1.1 (Rabinovich et al., 2008 (link)). The effluc-eGFP-miR-124_3 × PT vector was modified by inserting eGFP into Thy1.1 between BamHI and BglII (Clontech, Mountain View, CA, USA) and 3 tandem repeats of miR-124 perfect target sequences (TTAAGGCACGCGGTGAATGCC) into XhoI site. Viral vector for miR-124 overexpression experiment was derived from pSMPUW-miR-GFP/Puro Lentiviral Expression Vector (Cell Biolabs, San Diego, CA, USA). MiR-124 sequence was obtained from miR-124 precursor sequence including the 100 base flank sequences on both ends of the stem loop from mouse genomic DNA by PCR and clone the blunt-end PCR fragment into the PshA I site of the expression vector. Primers were as follows: forward 5′-tcgaggattcgactgtcctccctctcttccatc-3′, and reverse 5′-tcgagctagcgacttgtactgtgggcgcctgcag-3′. All constructs were verified by sequencing.

CRT-MG and U373-MG cells were maintained in RPMI 1640 medium (Hyclone, South Logan, UT, USA) with 10% heat-inactivated fetal bovine serum (FBS, G), 100 U of penicillin/mL, and 100 μg of streptomycin/mL (Thermo Fisher Scientific Korea Ltd., Seoul, Korea) as previously described [44 (link)]. U251-MG and U87-MG cells were grown in Dulbecco’s Modified Eagle Medium (DMEM, Hyclone, South Logan, UT, USA) supplemented with 10% heat-inactivated fetal bovine serum (FBS), 100 U of penicillin/mL, and 100 μg of streptomycin/mL. Primary rat and human astrocytes were maintained in 10% FBS-DMEM containing 1% nonessential amino acids (Thermo Fisher Scientific Korea Ltd., Seoul, Korea). Stable cell line CRT-MG/IL-8p-d2EGFP cells were prepared and maintained as previously described [45 (link)]. Briefly, stable reporter cell lines transfected with the human IL-8 promoter-luciferase reporter construct were generated. Then the construct and a destabilized enhanced green fluorescent protein (EGFP)-expressing plasmid, pd2EGFP (Clontech, Mountain View, CA, USA), were digested by using XhoI and BamHI (Clontech, Mountain View, CA, USA). The pd2EGFP backbone and the 546-bp insert containing the IL-8 promoter were ligated to generate IL-8p-d2EGFP.