Rotor gene real time pcr machine

Animals were euthanized by decapitation 30 min after the LD test and the whole brain was removed. The hypothalamus was immediately hand-dissected and snap-freeze in dry ice. The samples were then stored in −80°C for further molecular analysis. Total RNA was extracted from 8 to 10 samples per group using QIAzol (Qiagen; Hilden, Germany) standard protocol. The RNA concentration of each sample was measured with the NanoDrop spectrophotometer. From total RNA, 1.5 μg was reverse transcribed using the miScript II RT Kit (Qiagen). The following Quantitect primers (Qiagen) were used: Crh (QT0029389) and Crhr1 (QT00106232); and the following IDT primers were designed, verified for specificity and used for gene expression: Nr3c1 (Forward): GGACCACCTCCCAAACTCTG; (Reverse): ATTGTGCTGTCCTTCCACTG; Pgk (Forward): TGCACGCTTCAAAAGCGCACG; (Reverse): AAGTCCACCCTCATCACGACCC. SYBR green PCR reactions were run in duplicate for all samples in the Rotor-Gene Real-Time PCR machine (Qiagen). Fold change relative expression was calculated using the ΔΔCt method, using the CT group as a reference and the Pgk as an endogenous control for analysis. Due to RNA degradation, two samples were excluded from the CT group. After the analysis of qPCR data, two outliers from the ELS group were excluded from the Crh gene expression.

The IFNL3 polymorphism (rs12979860 C > T) was detected using an allelic discrimination real-time-PCR protocol based on the pre-validated TaqMan-MGB™ probe (Applied Biosystems, Foster City, California, US). Briefly, 1.25 μL of a 40X-combined-primer and probe-mix (ABI/Life Technologies, USA) was incorporated to 12.5 μL of 2X TaqMan® Universal-PCR-master-mix (ABI/Life-Technologies, USA) and DNA template and then complete to 25 μL final volume with DNase/RNase-free-water (Invitrogen/Life-Technologies, USA). The thermal profile of amplification was 95 °C for 10 min, 95 °C for 15s, and 60 °C for 1 min. The final two steps were performed 40 times. The Rotor-Gene real-time PCR machine (Qiagen, Santa Clarita, CA) was used for the PCR run. The Statistical Package for The Social Sciences (SPSS version 16.0; SPSS, Chicago, IL) was used to create Allelic discrimination plots.

Analysis of gene expression in transfected GALNT3 and GALNT3/T6 KO clones and corresponding mock-transfected clones (Ctrl) was performed by RT-PCR and RT-qPCR as previously described [8 (link)]. Total RNA was extracted from cells using an RNeasy Mini Kit (Qiagen, Germantown, MD, USA), according to the manufacturer’s protocol. For RT-PCR, 2 μg of RNA was used for reverse transcription. The cDNA was then subjected to PCR amplification using the primers listed in Table S1. mRNA data was detected on a 1% agarose gel with Safe-Green (Abm). Relative mRNA levels of target genes were normalized to GAPDH, which was used as a loading control. For RT-qPCR, RNA was reverse-transcribed into cDNA using Superscript III transcriptase, according to the manufacturer’s protocol (Invitrogen; Thermo Fisher Scientific, Waltham, MA, USA). RT-qPCR was performed using the SYBR Green PCR Master Mix (Applied Biosystems; Thermo Fisher Scientific Waltham, MA, USA) on a ROTOR GENE real-time PCR machine (Corbett Robotics, Qiagen, Germantown, MD, USA). Primers were designed as previously shown [8 (link)]; all primers for qPCR are listed in Table A1. Relative quantification of RNA expression was calculated using the 2^−ΔΔCq method [47 (link)]. The GUSB gene was used as an internal standard. Each sample was tested in triplicate.

For RT-qPCR, first total RNA was extracted using the RNeasy Plus Mini Kit (Qiagen, Hilden, Germany). RNA was then reverse-transcribed into cDNA using Superscript III transcriptase, according to the manufacturer’s protocol (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA). RT-qPCR was performed using the SYBR Green PCR Master Mix (Applied Biosystems; Thermo Fisher Scientific, Inc., Waltham, MA, USA) on a ROTOR GENE real-time PCR machine (Corbett Robotics, Qiagen, Hilden, Germany). Primers were designed as previously shown [42 (link)]; with the sequences freely available from the Entrez Nucleotide database and the Primer3 algorithm for primer design (https://www-genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi). All primers for qPCR are listed in Additional file 2. PCR volume was 20 μl, and conditions were as follow: initial cycle 50 °C, 2 min, 95 °C, 15 min; 45 cycles at 95 °C, 20 s, 60 °C, 20 s and 72 °C, 20 s; final cycle 72 °C, 30 s. Data were analyzed by the Rotor-Gene software using the comparative ΔΔCt method. The relative copy number was calculated based on the target gene/18S RNA ratio.
All values were expressed as the means ± S.D. Each sample was tested in triplicate.

The QIAamp Viral RNA Mini Kit (Qiagen, Milan, Italy) was used to extract the HCV-RNA from serum according to standard manufacturer's instructions, then the extracted viral RNA was amplified by real-time PCR by using Artus HCV QS RGQ Kit (Qiagen) following the manufacturer's protocols. The cycling conditions of amplification was initial incubation for 30 min at 51 °C, a second step of 10 min at 95 °C, followed by 50 cycles of 30 s at 95 °C and 1 min at 60 °C, followed by 40 cycles at 95 °C for 15 s, 60 °C for 1 min and 72 °C for 30 s. The amplified Fluorescence signal was detected at annealing/extension step of each cycle. Rotor-Gene real-time PCR machine (Qiagen, Santa Clarita, CA) was used for performing the amplification.

The changes in gene expression due to zinc deprivation were quantified by Real Time-PCR (qPCR) using Sensifast SYBR Green PCR Kit (Bioline, London, UK) on a Rotor-Gene Real-Time PCR machine (Qiagen, Hilden, Germany). Primers were designed using the integrated DNA technologies (IDT) primer quest tool (Integrated DNA Technologies, Coralville, IA, USA) except for the 16s rRNA gene primer that was based on Attia et al. (2010) [82 (link)]. Primers sequences, annealing temperatures, and expected amplicon size are shown in Table 4. Primers were manufactured by IDT and Macrogen Inc., (Seoul, Korea). The thermal cycling conditions were optimized as follows: initial activation at 95 °C for 2 min; followed by 35 cycles of denaturation at 95 °C for 5 s; annealing at 55–60 °C for 10 s; extension at 72 °C for 20 s followed by data acquisition after each cycle. All PCR tests were carried out in duplicates of each treatment from three different biological replica experiments. Expression of selected genes was presented as fold change normalized to 16s rRNA gene, house-keeping gene normalizer, and relative to the expression at 20 µM zinc.

Quantitative PCR (qPCR) of archaeal 16S rRNA was carried out as described earlier (Jeyanathan et al., 2011 (link)). Briefly, amplification of 16S rRNA gene fragments was carried out using the primer pair 109f (5′-ACKGCTCAGTAACACGT-3′) and 915r (5′-GTGCTCCCCCGCCAATTCCT-3′) using amplification parameters as described. qPCR was carried out in duplicate directly on undiluted and 1:10 dilutions of DNA, respectively, on a Rotorgene Realtime PCR machine (Qiagen, Hilden, Germany), using SYBR Green as the fluorescent indicator. Data was analyzed with the Rotorgene Q software, version 2.3.5.