Total RNA from the cultured cells was first extracted using TriPure Isolation reagent (Invitrogen Life Technologies, Carlsbad, CA, USA). The RNA concentration and purity were detected using UV spectroscopy (Thermo Fisher Scientific, Inc., Waltham, MA, USA). The RNA (1 µg) was reverse transcribed into cDNA using the Transcriptor First Strand cDNA Synthesis kit (Roche Applied Science, Penzberg, Germany). PCR amplification was performed using a Light Cycler instrument and the Light Cycler Fast Start DNA Master SYBR-Green 1 kit (Roche Applied Science) according to the manufacturer's instructions. Finally, gene expression was quantified relatively by ABI Prism 7700 Sequence Detection system. The primers for Snail were forward, CCACACTGGCGAGAAG and reverse, AGAAGGTCCGAGCACAC; the primers for GADPH were forward, GCACCGTCAAGGCTGAGAAC and reverse, TGGTGAAGACGCCAGTGGA. GAPDH was used as an internal control, and the relative expression level of Snail was calculated using the 2−ΔΔCt method.
Lightcycler faststart dna master sybr green 1 kit
Manufactured by Roche
Sourced in Germany, Switzerland, United States, Japan, Spain, France
The LightCycler FastStart DNA Master SYBR Green I kit is a ready-to-use reagent system for real-time PCR analysis. It contains all the necessary components, including FastStart Taq DNA Polymerase, reaction buffer, and SYBR Green I dye, to perform quantitative PCR with SYBR Green detection.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (20 mentions)
Lightcycler, by Roche (16 mentions)
Rneasy mini kit, by Qiagen (13 mentions)
Trizol, by Thermo Fisher Scientific (9 mentions)
Lightcycler 480, by Roche (7 mentions)
Reverse transcription system, by Promega (6 mentions)
Transcriptor first strand cdna synthesis kit, by Roche (5 mentions)
Lightcycler system, by Roche (5 mentions)
Superscript 2, by Thermo Fisher Scientific (5 mentions)
Superscript 3 first strand synthesis kit, by Thermo Fisher Scientific (4 mentions)
Lightcycler 480 system, by Roche (4 mentions)
Lightcycler 1, by Roche (4 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (4 mentions)
Lightcycler 2, by Roche (4 mentions)
Dnase 1, by Thermo Fisher Scientific (3 mentions)
Nucleospin rna 2 kit, by Macherey-Nagel (3 mentions)
Rnaprep pure plant kit, by Tiangen Biotech (3 mentions)
Abi prism 7300 sequence detection system, by Thermo Fisher Scientific (3 mentions)
Dnase 1, by Qiagen (3 mentions)
Rnase free dnase set, by Qiagen (3 mentions)
149 protocols using lightcycler faststart dna master sybr green 1 kit
1
Quantification of Snail Gene Expression
2
Quantifying UVRAG Expression in RGC-5 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from RGC-5 transfected with siRNAs using Trizol reagent (Fermentas, Pittsburgh, PA, USA). RT-qPCR was performed according to the standard protocol. The primers of UVRAG were 5′-ACTCCAGACTTGAGGCAAAC-3′ (forward) and 5′-ACAGATACTCACCATCTGACC-3′ (reverse). The primers of β-actin were 5′-AGGGAAATCGTGCGTGACAT-3′ (forward) and β-actin-R 5′-GAACCGCTCATTGCCGATAG-3′ (reverse). Quantitative PCRs were conducted by LightCycler Fast-Start DNA Master SYBR Green 1 kit and on a LightCycler 1.5 PCR machine (Roche). Data were analyzed using the comparative Ctmethod (2-ΔΔCt) and normalized to β-actin. All reactions were performed in triplicate. Results were expressed as fold changes compared to negative control.
3
Quantification of Dengue Virus Infection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA from dengue-2-infected cells was collected at various times. Complementary DNA (cDNA) was then generated from extracted RNA using a Superscript III first-strand synthesis kit (18080-400, Invitrogen), following the manufacturer's protocol. Then, 1 μg of cDNA was amplified by quantitative real-time PCR (qRT-PCR) in 20 ml reactions using a LightCycler FastStart DNA Master SYBR Green 1 kit (03515869001 Roche Diagnostics, Inc., Indianapolis, IN, USA), using primers specific for ATF4, CHOP (forward (Fwd): 5′-CAGAACCAGCAGAGGTCACA-3′ and reverse (Rev): 5′-CCAATTGTTCATGCTTGGTG-3′) and GADD34 (Fwd: 5′-CCAGAAACCCCTACTCATGAT-3′ and Rev: 5′-CCAATTGTTCATGCTTGGTG-3′), using a LightCycler 2.0 real time PCR machine (Roche Applied Science). We used NS4 A primers (Fwd: 5′-CGCACTGGACAACTTAGCAG-3′ and Rev: 5′-CGTGACTGTAGCCAGAAGTGTC-3′) to evaluate virus production in MDCK cells. Fold change was calculated by the following equation: 2^([dCt]), when dCt<0, or −1(2) ^ ([dCt]), when dCt>0, where dCt= difference between Ct values.
4
Real-Time PCR Analysis of Ion Transporters
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A measure of 200 ng of total RNA was reverse-transcribed (Thermo Fischer Scientific). Real-time quantitative PCR was performed on a LightCycler (Roche Diagnostics) using the LightCyclerFastStart DNA Master SYBR Green 1 kit (Roche Diagnostics) according to the manufacturer’s protocols, except that the reaction volume was reduced 2.5-fold. Specific primers were designed using Primer 3 (free online software; Supplementary Table S3 ). In each run, a standard curve was obtained using a serial dilution of stock cDNA prepared from a mix of different samples of total RNA. The expression of the CFTR, SLC26A4, NBCE1, and SLC26A9 transcripts were normalized to cyclophilin-A (PPIA) expression (the mean threshold cycle for PPIA = 27.5 ± 0.1).
5
qPCR Analysis of RAGE and S100 Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted using the TRIzol reagent (Invitrogen, Basel, Switzerland) following the protocol provided by the manufacturer. cDNA was synthesized from 0.5μg total RNA using a Reverse Transcription system kit (Promega). Specific primers for RAGE (Quantitect Primer assay, Quiagen AG, Hombrechtikon, Switzerland), S100A8 (fwd GGGAATTTCCATGCCGTCT, rev CCTTTTTCCTGATATACTGAGGAC), S100A9 (fwd CTGTGTGGCTCCTCGGCT, rev GCGTTCCAGCTGCGACAT), 36B4 (fwd GCAATGTTGCCAGTGTCTGT, rev GCCTTGACCTTTTCAGCAAG) and K14 (Quantitect Primer assay, Quiagen) were used. Real Time PCR was performed using Light Cycler FastStart DNA Master Sybr Green 1 kit (Roche, Switzerland).
6
Quantitative RT-PCR Analysis of Piwil2 and CREB2 in Rat Hippocampus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the CA1 subregion using Trizol reagent (Invitrogen, Carlsbad, CA). RT‐qPCR was performed according to the standard protocol. For each sample, 1 μg of RNA was reverse‐transcribed into cDNA in a final volume of 20 μl with 1 μl primer mix, 4 μl buffer and 1 μl enzyme mix (Takara, Shiga, Japan). The primers used are as follow: Piwil2: 5′‐ATGGAGTAGAATGCTGGGAA‐3′(forward), 5′‐CCTTGCTTGACCAAAAGCTC‐3′(reverse), CREB2: 5′‐TCGATGCTCTGTTTCGAATG‐3′(forward), 5′‐GGCAACCTGGTCGACTTTTA‐3′(reverse), β‐actin: 5′‐GCGTCCACCCGCGAGTACAA‐3′(forward), 5′‐TCCATGGCGAACTGGTGGCG‐3′(reverse) (Sangon Biotech, Shanghai, China). Afterwards, PCR was performed in a final volume of 25 μl with 2 μl of RT product for cDNA amplification. Annealing temperature was 60°C. Quantitative PCRs were conducted by LightCycler Fast‐Start DNA Master SYBR Green 1 kit and on a LightCycler 1.5 PCR machine (Roche Light Cycler 480, Germany). Each sample was run in triplicates. All of the samples were quantified against the same standard curve, and each expression level was normalized to β‐actin expression. Data were analyzed using the comparative Ct method (2−ΔΔCt). Results were expressed as fold changes compared to Sham group.
7
Quantitative Real-Time PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Macrophages cultured in 6-well plates were lysed in Trizol reagent (Life Technologies). RNA was isolated and reverse transcribed [40] . Levels of the cDNA of interest were measured by qPCR (LightCycler FastStart DNA Master SYBR Green 1 kit; Roche Diagnostics). The absence of genomic DNA contamination was verified by treating RNA samples in parallel without reverse transcriptase and controlling for the absence of amplification by qPCR. Gene expression was normalized over cyclophilin and HPRT (Hypoxanthine-guanine phosphoribosyltransferase) RNA levels. The sequences of the primers used for qPCR are given in Supplementary Table 2.
8
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative reverse transcription polymerase chain reaction (qRT-PCR) was performed using a LightCycler FastStart DNA Master SYBR Green I Kit (Roche Diagnostics, Basel, Switzerland). The detailed methodology is presented in the Supplementary Methods . Primer sequences are listed in Table S2 .
9
qRT-PCR Analysis of Stress-Responsive Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The expression of ER- and salt-stress responsive genes in leaves were confirmed by qRT-PCR analysis. Total RNA was extracted from samples as above and treated with DNase I (Fermentas, USA). First-strand cDNA was performed by using the Transcriptor First Strand cDNA Synthesis Kit (Roche, Switzerland) according to the manufacturer’s protocol. Primers used are listed Table 1 .
LightCycler® FastStart DNA Master SYBR Green I Kit (Roche, Switzerland) was utilized for preparation of qRT-PCR reactions and reactions were run by using Roche LightCycler 480. Three replicates were conducted to analyze the expression of each gene under each condition. 2-ΔΔCT method was used for calculation of relative expression levels [39 (link)]. Transcript abundance was normalized to that of eIF4α (Vitis vinifera eukaryotic initiation factor 4A-8 (LOC100261822,XM_002277667.3 ).
LightCycler® FastStart DNA Master SYBR Green I Kit (Roche, Switzerland) was utilized for preparation of qRT-PCR reactions and reactions were run by using Roche LightCycler 480. Three replicates were conducted to analyze the expression of each gene under each condition. 2-ΔΔCT method was used for calculation of relative expression levels [39 (link)]. Transcript abundance was normalized to that of eIF4α (Vitis vinifera eukaryotic initiation factor 4A-8 (LOC100261822,
10
Quantitative RT-PCR Analysis of pIgR Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The isolation of total RNA from the rat submandibular glands and cDNA synthesis was performed as previously reported [22 (link)]. Quantitative real-time PCR was performed using a LightCycler 480 system (Roche Diagnostics Limited, West Sussex, UK), as previously reported [22 (link)]. The primer sequences used to amplify the pIgR gene sequence were the following: 5′-TGG GAG CTA CAA GTG TGG TC-3′ (forward primer) and 5′-GGG TGT CAT TTG GGA ATC CAG-3′ (reverse primer). The TaqMan probe was designed and synthesized by Nippon Gene Research Laboratory (Miyagi, Japan) and has the following sequence: FAM-5′-TTC GAT GTC AGC CTG GAG GTC AGC-3′-TAMRA. As a control, the β-actin housekeeping gene was amplified using the LightCycler, FastStart DNA Master SYBR Green I kit (Roche Diagnostics Limited) following the manufacturer’s instructions (Nippon Gene Research Labs, Inc.). The primer pair used was the following: 5′-CTT GTA TGC CTC TGG TCG TA-3′ (forward primer), and 5′-CCA TCT CTT GCT CGA AGT CT-3′ (reverse primer). The primers were validated by performing a melting temperature analysis and by inspection of the DNA bands by agarose gel electrophoresis.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!